Chapter 392: Table of Contents – RNA Methods: A Laboratory Guide to Isolation and Characterization (2023)

Index

Page numbers followed by e refer to figures or tables.

AAUAAAA-Reason, 122

Abbreviations, 855–858

Absolute Quantification, 320

Absolute Quantification Method, 309-310

absorption rate, 189

absorption rates, 183-191

Frequency Categories, 121–122

Accession number 681

Acid-phenol method, 95-96

Acridinnaranja, 442

Acrylamide, 805

β-actina, 264

Activated Vectors, 220-221

Adapter, 206

Adapter-linked cDNA tester for hybridization and PCR,

Adenine (A), 501

Adenine and thymine (A::T), 75

adenine and uracil (A::U), 75

Adenine/uracil-rich element (ARE), 38

Adeno-associated virus, 387-389

Adenovirus Sequences, 759-760

additions,

AE-Puffer, 837

Aerial Tissues in Plants, 164–165

Aerosol Contamination, 237–238

Aerosol Resistant Tips, 237-238

affinity matrices, 85

Agarosegele, 809

Electrophoresis, 804

without the use of suitable filters,

Alfredo,verAllele Frequency Database (ALFRED)

alignment, 713

Alkaline Stain Techniques, 482-483

Alkaline buffers, 500

Alkaline Phosphatase (AP), 611

Alkaline Phosphatase-Based Chemiluminescence Methods, 646–648

All of Us Research Program, 766–767

Allele Frequency Database (ALFRED), 732–733

Alternative splicing of messenger ribonucleic acid from a single gene locus, 42

alternative splicing of transcripts

differential junction,

ARNi e 395-396

α-Amanitina, 595

Amberlitharz, 815

amino acid, 682

molecules, 12

Episode, 736

Information, 497-498

5-(3-Aminoallyl)-2'-deoxyuridine-5'-triphosphate (dUTP), 641-642

Ammonium sulfate, 255

Ampicillin, 837

amplicon, 235

pollution, 235

Amplification Techniques, 201

AMVRT,verAviäre Myeloblastosevirus RT (AMV RT)

Anatomy, 743–744

anchor nucleotide, 205

Anker-PCR, 272–273

Anchor rope, 272–273

Angiogenesis, 728

Anionic Surfactant, 801

anions, 804

glitter, 495

the pamphlet, 228-229

process, 71

Annealing temperature 254-255

The reaction of the anode, 803

Anti-DIG antibody, 611

Antiandrogenic Drugs, 734

antibodies (Abs),

Antibody-Mediated Panning Methods, 653

lines, 753

Micromatrices, 850-851

Anticodon, 12

Antiparalelo Basenpaarung, 206

Antisense cRNA Probe, 610-611

ARN antisentido, 384

Probe Synthesis, 509-513

Antisentido-Strang, 18–19

Antisense Transcripts, 559

AP,verAlkaline phosphatase (AP)

Aptameros, 749

biology, 691

oligonucleotide sequences,

aqueous buffer, 54

Aqueous Hybridization Buffers, 497-498

THEY ARE,verAdenine/uracil-rich element (ARE)

Argonaut (behind), 376–377

Family proteins, 376-377

Protein, 376-377

Assay Sensitivity, 773-774

Considerations, 126

Cleaning,

Gene Expression Study, 631–632

assess the integrity of RNA samples,

Asymmetric PCR, 651-652

A-cauda of blunt PCR products, 286-287

AUG-Codon, 32

Autoclave, 418–419

Autofluorescencia, 611

Autoradiography/Autoradiography, 670-671

Reflections, 534–542

Exposure time, 537

Handling of filtering membranes, 535

Intensifying Screens, 537–539

Preflash Blade, 539

X-ray Film Processing, 539–542

security light, 537

cassette type, 539

X-ray film, 535–536

Recognition,

traditional, 496

Vogelmyeloblastosevirus RT (AMV RT), 208

BAK,verBacterial artificial chromosomes (BACs)

Post Amendment Process, 358-359

backbone of the molecule, 7

Bacterial Artificial Chromosomes (BACs), 844

bacterial Colony Replicate Coating Tool,

cooking process, 489

banda, 445

Barcode, 698

Yield-RNA,

Isolation of, 171-173

Base pairing of two complementary RNA strands, 72

Basic Location Alignment Survey Tool (BLAST), 692

DNA b,verBranched DNA (bDNA)

BeadBeater Homogenization,

Plataforma BeadChip, 633-634

Lei Bier-Lambert, 184–185

Bentonite, 58

Best Guess Oligonucleotide Sequence, 250-251

Betaine, 255

Bi-Probe, 316

Bicistronic Messenger Ribonucleic Acids, 38-39

mRNA bikes, 40-41

big data, 702

analysis, 681

Binary Quantization, 320-321

bioanalyzer

sheet, 705

instrumentation, 197

Biobankindustrie, 767

biobanco, 767

Biofluids, 736

Bioinformatics, 777

Approaches, 711

Aptamer Biology, 691

Epitranscripción, 685-688

Basic Vocabulary, 681–684

Gen, 692-694

Methods, 750–751

Justification, 679-681

RNA-Chromatin, RNA-RNA, and RNA-Protein Interactions, 688-690

CLIP-Workflow,

Transcriptomes and Transcriptomics, 684-685

Biological integrity of mRNA, 200

Biological Material, 767

Biological Samples, 767

Biomarkers Qualification Program, 732

Biomarker, 723-726

Biomarker Problems and Deficiencies, 736-738

useful multiomics features,

Characteristics of Useful Biomarkers, 726-727

circulating RNA, 730

Exosomes are small vesicles enclosed in a membrane.

Development, 732

Biomarker Identification for Research and Diagnostic Applications, 731–736

DNA Focuses, 732-733

Metabolomic Approaches, 736

protein approaches, 736

RNA Approaches, 733-735

Editions, 736-738

miARN, 727-730

variety of biomarkers,

miRNAs and disease detection,

Justification, 723;

Demonstration, 723

Company, 737

traditional,

useful multiomics features,

Uses of,

Biomolecular Imagers, 465

Biomolecular Interaction Network Database, 850–851

Biopharmacy, 723

Biosensores, 632

Biocompartir, 306–307

Biotech Revolution, 629

Biotin, 614-615

Biotinilato de probe, 611

Biotinylation, 651-652

Bit score, 682

Bitmap (BMP), 462

Bits per pixel (BPP), 457

BUST,verBasic Local Alignment Search Tool (BLAST)

BLASTn,verBLAST nucleotide (BLASTn)

Cation Groups Block, 605-606

Spot Analysis, 503

Transfer membrane, 477-478

Choice of, 474-477

Nitrocellulose, 476

Nylon, 475–476

PVDF, 477

for nucleic acid transfer, 474

Dealing with post-fixation, 491–492

up, 473

Blotting papers, 480

Blotting period, 480

BMP,verBitmap (BMP)

Body Mass Index,

Bone density,

Bouguer-Bier-Gesetz, 184–185

bovine Pancreas,

Rinderserum Albumin (BSA), 619

bovine thrombin, 255

BPP,verBits Pro Píxel (BPP)

branched DNA (bDNA),

breast cancer, 734

Bridge reinforcement, 700

RNA bridge, 260

shine, 458

5-bromo-4-chloro-3-indolyl-phosphate (BCIP), 611

Bromophenol Blue, 567-568

Bromouridina, 716–717

5-bromuridina (BrUrd),

brurd,ver5-Bromuridina (BrUrd)

BSA,verBlood Serum Albumin (BSA)

Bulk Packaged Polypropylene Products, 59

Blown UV lamps, 461

CAAT Box, 16–17

Cajal corpos (CBs), 23

Calcium Phosphate, 651–652

calf intestinal phosphatase (CIP), 273

Camera

condensation effect on the camera lens,

Attitudes, 466–467

Canonical Base Pairing, 71

Cap Junction Complex (CBC), 31

Hair transfer, 478-480

covered, 31

Reaction, 30–31

CaptureSeq, 714–715

Heart attack, 728–729

Cardiovascular diseases, 737

Transport molecules, 129-130

cartridge cleaning, 253

cas-protein,verCRISPR-associated proteins (Cas proteins)

Cassettes, type 539

bowl for pouring, 445

catalytic RNA,

Cathodic Reactions, 803

Catrimox-14, 58 cationic surfactant

complete blood count,verCap Junction Complex (CBC)

circuit breakers,verCajal Bodies (CBs)

CCD,verCharge Coupled Device (CCD)

sDNA,vercomplementary DNA (cDNA)

Cdr1as, 370

CEL-Seq, 715–716

Zellfreie RNA (cfRNA), 730

cells, 107

cellless translation system, 200

Culture, 155

alternative protocol to prepare cell nuclei from , 583-584

Lisemétodo, 142

granules, 118

Cell biochemistry, 759

Cellular Disorders, 636

cell function, 734

cell lysis, 579

cell process, 375

Dogma Central, 12-14

centrifugation, 157-158

Applications, 824–827

centrifuge tubes selected for common molecular biology applications,

density gradient, 826

Differential, 824-825

O rotor, 822-823

centrifuges, 109

O rotor, 822-823

Types,

Certified Nuclease Free Solutions, 61

Cassium Chloride (CsCl), 826–827

Earrings, 100-103

cesium salts, 66-67

cesium sulfate 826-827

Cesium trifluoroacetate (CsTFA), 826-827

Earrings, 104-107

Preparation, 104-107

Cetyltrimethylammonium Bromide (CTAB), 178-179

ARNcf,verZellfreie RNA (cfRNA)

Phenol Guanidinium Chaotropic Acid Thiocyanate Extraction, 591-593

Chaotropic Light, 597

Blower, 93–94

Charge Coupled Device (CCD), 462

Chemical Fix, 609–610

chemiluminescence

and autoradiography for the detection of hybridization,

detection, 611

Chemogenomics, 682

switches,verCromatina-Imunprezipitation (ChIP)

Chip reader, 643

Chloro-1-naphthol, 534

chloroform, 592

Cloroplasteno, 603

chromosomes, 683

genome, 168

Cromatina-Imunprazipitation (ChIP),

Chromatography, 651-652

Chromogenic Detection, 611

procedure, 534

anomalian chromosomes,

Chromosomal Translocations, 496

kvp,vercalf intestinal phosphatase (CIP)

circus rna,verARN circular (circARN)

ARN circular (circRNA), 730

exosome,

form And Function,

Circulating Nucleic Acids (CNAs),

Circulatory system, 763-765

siRNA,verintrinsic circRNA (ciRNA)

769–770

Classical Genetics, 754–756

Classical Molecular Biology Membrane, 476

Classic RACE, 283

Clinical manifestation, 723

SHORTEN,verCross-linking immunoprecipitation (CLIP)

Klonale Amplification, 320–321

clones, 320

SNA, 217-221

Gene expression area, 217

PCR Products, 285-289

TA-Klonen,

Clustered Regular Interspersed Short Palindromic Repeats (CRISPR), 401–402

Focus, 402–404

System CRISPR-Cas9, 759–760

Revolution, 404

Technology, 746

Type II Locking System, 401–402

set, 769

CNA,verCirculating Nucleic Acids (CNAs)

Coated blades, 606

coding

district, 32

RNS,

strange, 18-19

Comparative anatomy of siRNA and shRNA,

comparative Genomics,

Competitive Polymerase Chain Reaction, 338-345

ver AlsoReal-time polymerase chain Digital polymerase chain reaction

10-fold primary dilution series for mass determination,

primary amplification, 341-343

Secondary reinforcement, 343–345

double dilution secondary series for mass determination,

Synthesis of the first strand of cDNA, 340-341

Synthesis of a Non-Homologous Competitor, 338-340

quantification of transcripts by competitive polymerase chain,

unit analysis,

Complementary DNA (cDNA), 491

Applications, 221

Evaluation of the efficiency of cDNA synthesis, 216

Evaluation of the synthesis of the first chain of cDNA by electrophoresis,

Clones, 217-221

Binding Enzymes, 220-221

Linkage Considerations, 218–220

Downstream Primer Design, 666-668

First-strand cDNA synthesis, 214-216

Fragmentation, 698

Microarranjos, 632

molecule, 221

PCR amplification of, 284-285

Episodes, 652

Synthesis, 708-709

Reflections, 125–126

enzymes associated with cDNA synthesis and cloning,

First Strand Considerations, 203-207

Legacy Methods, 212–214

PCR-based methods, 212

process, 231

Reverse transcriptase options, 207-211

Considerations of the second branch, 211

Complementary Nucleic Acid Molecules, 495

Complementary RNA (cRNA), 632-633

Complementary Sequences, 497

Complementary Diana Molecules, 503

Composite Primer, 326

Composites, 55–56

cesium salts, 66-67

know guanidinium, 64-65

8-Hydroxyquinoline, 66

Sixty-five

Phenol: chloroform: isoamyl alcohol, 65–66

Proteinasa K, 67

PVSA, 64

Safety Data Sheet, 65

to control nuclease activity, 64-68

Computational Bioinformatics, 702

Computer Methods, 738

consensus sequences, 14-15

Modernes Infinium BeadChip-Array,

with you, 682

Label continues, probe molecule, 496

Contrast, 458

Control Reaction Formats, 325-328

Construction of a non-homologous concurrent DNA model,

transcription frequency interpolation with standard curve,

Synthesis of transcription model by polymerase chain reaction,

construction of models for in vitro transcription,

control RNA, 643-644

Conventional Electrophoresis, 809

Conversions, mass to moles, 793-796

coplin Glass,

nuclear genes, 844

Corex-Glasröhre, 582

Coronavirus disease 2019 (COVID-19), 760

Disease,

Key vocabulary,

vaccinations, 759

Keimblatt-ARN,

Counts per minute (cpm), 832-833

coupling reaction, 642

capa, 698

COVID-19,verCoronavirus disease 2019 (COVID-19)

cP-RNA-seq, 717-718

chemical structures of RNA termini,

cpm,verCounts Per Minute (cpm)

CRISPR,verClustered Regular Interspersed Short Palindromic Repeats (CRISPR)

CRISPR-ARN (ARNcr), 403

CRISPR-associated proteins (Cas proteins), 401-402

ARNc,vercomplementary RNA (cRNA)

Cross Hybridization, 651–652

Cross-linking immunoprecipitation (CLIP), 689

workflow,

network process, 689

Crosslinking of the Ribonucleoprotein Complex, 154

ARNcr,verCRISPR-ARN (ARNcr)

paintings, 799

Cryostato, 608–609

Cryptic Intron, 395-396

CsTFA,verCesium trifluoroacetate (CsTFA)

Method, 309–310

CTAB,verCetyltrimethylammonium bromide (CTAB)

SNA, 35

Cy-marked targets, 643

Dyes Cy3, 849

Dyes Cy5, 849

cycloheximide, 663

cyclophilin, 265

Cyclophilin A, 265

Cystic fibrosis, 732–733

Citidine, 184–185

Cytogenetic Diagnostic Tool, 603

Cytokines, 635

Cytoplasm, 680-681

cytoplasmic mRNA, 503

cytoplasmic RNA, 579

Isolation

Mild hypotonic lysis, 87-93

Column of silicic acid, 84-85

cytoplasmic rRNAs, 705-708

Cytosine (C), 553

Zitoskeleton, 635

Cytosolic content, 572-573

D-max, 467–468

D-min, 467–468

POINT,verDiaminobencidina (DAB)

Data Analysis Procedures, 701

Data mining, 843

database, 699

Database of Genotypes and Phenotypes (dbGaP), 776

dbgap,verDatabase of Genotypes and Phenotypes (dbGaP)

DDBJ,verJapan DNA Database (DDBJ)

ddNTP,verDidesoxinucleotídeo (ddNTPs)

ddPCR,verDigital droplet PCR (ddPCR)

ddRNAi,verDNA-directed RNA interference (ddRNAi)

first Degenerate,

degradation

products, 553

strategy, 38

Deidrin-2-Gen 282–283

deionization, 817

demethylation, 370

Proven Accuracy, 732

Denaturation, 227-228

Denaturation System, 417

Denhardt's Solution, 837

Density Analysis, 459

Density Gradient Centrifugation, 826

cesium chloride, 99-103

Cesium trifluoroacetate, 103–107

typical buoyancy density ranges of DNA, RNA, and proteins,

Deoxynucleotidyltransferase, 506–507

Deoxyribonuclease (DNase), 797-798

ADNasa I, 797-798

DNase-free RNases, 799

Removal of DNase Activity from Homemade RNase Stock Solutions, 800

Deoxyribonucleic acid (DNA), 837

Die Technology, 640

digestion, 798

DNA-dependent DNA polymerase, 208

DNA:RNA hybrid, 72

Location Points, 835–836

Isolation of DNA from the same source, 107-111

methylation,

Molecules, 683

Nucleoside, 3

nucleotides, 3

Probe Synthesis, 505-509

DNA 5' end tag, 508-509

Translation of Nick, 508

Polymerase Chain Reaction, 507-508

random initiation, 508

DNA 3' end tag, 509

Restoration of, 110–111

Deregistration, 798

sequences, 644

Information, 680–681

Sequencing, 670-671

Submission, 554-555

Therapeutics, 759–760

Deoxyribose, 4

dewaxed, 146

DEPC,verDietilpirocarbonato (DEPC)

deprotection process, 253

Entsalzung, 253

Recognition, 605-606

Autoradiography, 542-545

Exposure time, 537

Handling of filtering membranes, 535

Intensifying Screens, 537–539

Preflash Blade, 539

X-ray Film Processing, 539–542

security light, 537

cassette type, 539

X-ray film, 535–536

by chemiluminescence, 529-533

Methods, 565–568

nonisotopic methods, 528-534

chromogenic detection methods, 534

Chemiluminescence Detection, 529-533

Phosphor Imaging and Digital Detection Systems, 527–528

Early, 527-545

Processes, 610-612

system, 504

Techniques, 495

Developmental Biology, 603

Devittelization, 621

DHFR,verDihydrofolate reductase (DHFR)

diagnostic applications

Identification of biomarkers for research and, 731–736

DNA Focuses, 732-733

Metabolomic Approaches, 736

protein approaches, 736

RNA Approaches, 733-735

2,7-diamino-10-ethyl-9-phenyl-phenanthridinium bromide (EtBr), 436

Diaminobencidina (DAB), 611

Diazobenciloximetilpapel, 476

Data, 382–383

data-1,379

Specific Dysfunctions of Dicer, 727-728

Dideoxy Chain Termination Methods, 699–700

didesoxinucleotídeo (ddNTPs), 698

Dietilpirocarbonato (DEPC), 62

Differential Centrifugation, 824-825

Differential Gene Expression, 733

graben,verDigoxigenin (DIG)

digestion

about ADN, 798

RNA, 800

Digital Recognition Systems, 527–528

digital images, 465

Analysis, 462-463

PHOTO/Analyst Luminary/FX-Workstation,

pixel bitmap,

Software,

Processing, 455–456

Digital Imaging Systems, 466

PCR digital (dPCR), 320

Imaging systems for digital photographic documentation, 465

Scanning Process, 455–456

Digoxigenin (DIG), 625

Dihydrofolate reductase (DHFR), 265

Dilution Process, 321

Dimethylsulfoxide (DMSO), 783

Dinitrophenyl (DNP), 633–634

diploid cells, 653

Direct Enzyme Labeling, 516

Direct Sequencing of RNA Molecules, 698

disodium salt 786

Closed System Disposable Tissue Shredder,

Disposable homogenizer generators, 139

Disposable plastic trays, 186

Ditiotreito (TDT), 94

DMSO,verDimethylsulfoxide Glyoxal/Dimethylsulfoxide (DMSO)

DNS,verdeoxyribonucleic acid (DNA)

Japan DNA Database (DDBJ),

DNA-directed RNA interference (ddRNAi), 387-389

AdNasa,verDeoxyribonuclease (DNase)

ADNasa, 797

DNP,verDinitrophenyl (DNP)

(Video) Back to basics: Fundamental concepts and special considerations in RNA isolation

precursor, 505

Documentation materials, 692.

Point Transfer Analysis, 613-614

Pros and Cons, 829–831

appropriate positive and negative controls, 832

Date Limitations, 832-833

Protocol, 835-836

Doty Equation, 501

double-stranded cDNA, 654

Phyta dupla DNA (dsDNA), 185

Probes, 550-551

double-stranded miRNA, 381

Double-stranded molecules, 759-760

Types,

Double-stranded probe renaturation, 578

Double-stranded RNA (dsRNA), 604-605

Probes, 550-551

double sex (dsx),

Dounce Homogenization, 140-141

Dounce-Homogeneizador, 584

Down Regulation, 653-654

downstream, 8

Primary, 239–240

Downstream Promotion Element (DPE), 16–17

dPCR,verPCR digital (dPCR)

DPE,verDownstream Promoter Element (DPE)

Conductor, 652

SNA, 658

Drop-Seq., 715

digital droplet PCR (ddPCR),

products after the first round of amplification,

Protocol, 671

Drosha's prosecution, 368–369

Drug Discovery Process, 681

Pharmacotoxicology of Drugs, 724-725

Dry Electroblotting, 482

DS-34, system 465

dsdn,verPhyta dupla DNA (dsDNA)

dsRBD,verdsRNA binding domain (dsRBD)

dsRBP,verdsRNA binding domain protein (dsRBP)

dsRNA,verdouble-stranded RNA (dsRNA)

dsRNA binding domain protein (dsRBP), 380

dsRNA-binding domain (dsRBD), 379

TDT,verDitiotreito (TDT)

duplication, 495

Duplex Molecules, 558-559

Duplex Stability, Affecting Factors, 497–505

Dynabeads, 126–128

Eberwine linear amplification process,

Eberwine Method, 640–641

EcircRNA,verExonische circRNA (EcircRNA)

ECL system,verEnhanced Chemiluminescence (ECL System)

ECM,verExtracellular matrix (ECM)

EDTA,verEthylenediaminetetraacetic acid (EDTA)

EEE,verElectroendosmosis (EEO)

EIciARN,verExon-intronische circRNA (EIciRNA)

eIF,verEukaryotic Initiation Factors (eIF)

18S-rRNA, 266

EJCverExon-Junction-Complex (EJC)

Electromagnetic Techniques, 482

Electroendosmosis (EEO), 804

Electronegatives Atom, 7–8

Electronic Solid Phase, 496

Electrophoresis, 699–700

Agarose-Geleeletrophorese, 804

voltage applied to 807-808

Basic Composition and Temperature, 809

ethidiobrometo, 808

Field Address, 809

yellow, 810

Maintenance of electrophoresis equipment, 811

Sample Molecular Size Range, 807

nucleic acid conformation, 807

Polyacrylamide-Geleeletrophoresis, 805–806

process, 473

RNA, 423-424

common rRNA molecular size standards,

Comparison of eukaryotic RNA profiles from different species,

direct measurement of poly(A) content, 411-416

Some Tips for Analyzing Agarose Gels for the First Time, 445–449

Formaldehyde Denaturation, 418-421

Gel Stain Options, 436–444

Glyoxal/Dimethyl Sulfoxide Denaturation, 422–425

intramolecular base pairing requires RNA denaturation, 416-418

Sample Normalization by Nucleic Acid Concentration, 410–411

proper use of molecular weight standards, 426-428

Protocol, 413-416

ARN ribosomal, 428-435

RNA Analysis on Non-Denaturing Gels, 425-435

Equipment Maintenance and Safety Considerations, 444–445

urea denaturation, 421

SYBR dye family, 808-809

theoretical considerations, 802-803

Gel Box Types, 809–810

RNA electrophoretic profiling, 191-195

assess the integrity of RNA samples,

High quality mammalian RNA electrophoretic profiling,

SYBR Green II staining of RNA samples,

electrophoretic stains,

Electrophoretograms, Optimization Tips, 468–472

electroporation, 390

ELISA,verEnzyme immunosorbent assay (ELISA)

Elongation (transcription phase), 24-26

EMBL,verEuropean Molecular Biology Laboratory (EMBL)

EMBL-EBI,verEMBL-European Institute of Bioinformatics (EMBL-EBI)

EMBL-European Institute of Bioinformatics (EMBL-EBI), 691-692

Embryos, 606–608

end tag, probe molecule, 496

Endpoint Analysis, 266

Endpoint PCR, 307

Final Repair Primer, 281

Endless RNA Technology (eRNA Technology), 360-361

Endogenous Enzyme, 611

endogenous miRNA, 729

Endogenous RNase, 178-179

Activity, 52–53

Endogenous Silencing Pathways, 380-381

Endoplasmic Reticulum (ER), 153

Endorribonucleasa, 553

energy conversion process, 467

Enhanced Chemiluminescence (ECL System), 532

Nucleic Acid Labeling System, 504

amplifier, 17

Enhancer RNA (eRNA), 38

enrichment strategy, 121

Enzymatic Cleavage Methods, 699-700

enzymatic degradation,

Enzymatic process, 702-703

Enzyme Blends, 276-278

Enzyme-Linked Immunosorbent Assay (ELISA), 736

ELISA-based variant, 549

Difficult

related to cDNA synthesis and cloning,

used for ligation, 220-221

Epigenetics, 751

changes, 370

events, 44

Modifications, 687

RNA, 685-688

epigenoma,

epigenomics,

Summary,

epitope recognition, 691

Epitranscripción, 685-688

epitranscriptionally modified nucleotides, 687

Equipment Providers, 859–866

Y,verEndoplasmic Reticulum (ER)

ERCC,verExternal ANN Control Consortium (ERCC)

ARNe,verRNA Enhancer Excellent RNA (ARNe)

RNA Technology,verEndless RNA technology (eRNA technology)

Escherichia658

system without cells, 200

single-chain binding protein, 255

BSO,verRapid Sequence Tag (EST)

EtBR,verEtidiobrometo (EtBR)

ethanol evaporation process, 152

Etidiobrometo (EtBR), 838

Removal of, 814-815

EtBr-stained RNA gel, 193-194

Green Bag, 814–815

Ethylenediaminetetraacetic acid (EDTA), 587

838

Euchromatin, 377

Eukaryotes, 769-770

Eukaryotic cells, 595

eukaryotic enzyme, 24

Eukaryotic exosome substrate, 38

Eukaryotic Gen, 769-770

Eukaryotic Initiation Factors (eIF), 31

eukaryotic mRNA, 121-122

Eukaryotic Organisms, 163

Eukaryotic Proteins, 736

Eukaryotic Ribosomes, 428-429

European Molecular Biology Laboratory (EMBL),

Exact Match Probes, 502-503

Exact Match Strings, 72–73

Exogenous Controls, Quantitative Polymerase Chain Reaction Techniques, 323–324

Exogenous Silencing Strategies, 384-385

Comparison of siRNA and shRNA for RNAi,

exome,

Exon-Junction-Complex (EJC), 23

Exobinding, 22–23

exon skipping, 42

exon trap, 22

Exon-intron junctions, 629

Exon-Intron-Mapping-Assays, 552–553

Exon-intronische circRNA (EIciRNA), 359

Exonische circRNA (EcircRNA), 359

Éxons, 769–770

exosomal RNA (exRNA),

Exosomo, 730

small membrane-bound vesicles

Transport vehicles, 730

Expected value (E value), 694

Export-5, 364–365

Exposure time, 537

Rapid Sequence Tag (EST), 683

exRNA,verextracellular RNA (exRNA)

Extensive Intramolecular Base Pairing, 71

External ANN Control Consortium (ERCC), 698

External Size Standards, 426-427

Extracellular matrix (ECM), 136-137

Extracellular RNAs (exRNAs), 704-705

Extraction

blower, 89

Nuclear RNA for Steady State Analysis, 596-597

Error Sequences, 197–198

Farrell's RNA Sensitivity Index, 775

press, 683

FAST, 683

FDA,verFood and Drug Administration (FDA)

fabric FFPE,verFormalin-fixed paraffin-embedded tissue (FFPE tissue)

Ficoll, 98–99

Film Image Analysis, 460

Filter, 460

filter-based essays, 611

A membrane, 496

Preparation, 523–524

Filtration Methods, 460-461

Finger, 58–59

First Strand cDNA Synthesis, 340-341

First-chain synthesis products, 216.

FISCH,verFluorescence in situ hybridization (FISH)

5'Cabo, 29–31

5'Dimethoxytritilo (5'DMT), 253

5' final sequences, 206

final 5' mark

on ADN, 508–509

of RNA, 513

5'nuclease assay for real-time polymerase chain reaction,

5' Primer, 239–240

5'RACE-PCR, 271-273

effect of terminal deoxynucleotidyl transferase,

5' RLM CARRERA, 282

5'RNA ligasa-mediated RACE (5'RLM-RACE), 273

5' (tri)phosphate, 7

5' untranslated region (5' UTR), 31

fixing process, 611

Fixing Solution, 606-608

Fixed, paraffin-embedded specimens, 609–610

Fixed Angle Rotor, 822-823

Fixed tissue, RNA isolation from, 146-147

Shock freezing of leaf tissue, 169

quick frozen tissue,

Floral tissue RNA, 163

Liquid matrices, RNA isolation from , 116-118

Fluorescein, 519

fluorescence, 611

Edition, 640

Microscopy, 610–611

Reason, 643-644

fluorescent in situ hybridization (FISH),

fluorescence Resonance Energy Transfer,verFörster resonance energy transfer

Fluorescent Dyes, 670-671

EtBR, 838

SYBR verde, 813

Fluorescent Label, 641–642

Fluorescence probes, 550

two-dimensional fluorescent gel electrophoresis,

Fluorescently Labeled Antibodies, 633-634

Fluorescently Labeled Probes, 603

Fluorocarbon Polymer, 477

5' Fluorogenic Nuclease Assay, 312–314

Fluorophore-labeled cDNA molecules, 684

Fluorophore-labeled cDNA populations, 631-632

Detection of fluorophore-labeled tyramide, 612

Food and Drug Administration (FDA), 765

formaldehyde, 834

deionization, 818

Denaturation, 418–421

formaldehyde denaturing gels, 419-421

Yellow

RNA transfer, 483

TurboBlotter downlink, 486

Formalin Fixed Paraffin Embedded Tissue (FFPE Tissue), 728-729

Formamide 834

deionization, 818

Effect of formamide on rigor, 75-76

Formamide-based entourage, 550–551

Formamide-Free Hybridization Buffers, 497-498

Förster's Resonance Energy Transfer, 312–314

subunit 40S, 428-429

4-Tioridin, 689

fragmentation process, 708

Fresh Frozen Brain Tissue for ISH, 615-617

Fresh tissue, RNA isolation from, 144-145

Freshly Deionized Formamide, 504

Fresh frozen tissue, 606

Newly Isolated Tissues, 608–609

Friction force (F), 802

Frozen tissue, RNA isolation from, 145-146

Fruit RNA, 163

Isolation of, 173-176

Full-length cDNA molecules, 231-232

Full Transcripts, 559

functional Genomics,

Functional Genomic Approaches in Common Use, 745–753

aptamers comprising carefully selected oligonucleotide sequences,

Cromatina-Imunpräzipitation,

twodimensional Fluorescent Gel Electrophoresis,

genetic Mapping,

genome-wide Association Study,

Definition, 743–744

meaning of, 744-745

Justification, 743;

Relationship of Functional Genomics Approaches to Classical Molecular Biology, 753–756

GRAMS

ΔG (Gibbs free energy), 250

Elemento G-Box, 16–17

G+C content, 504

G·HCl,verGuanidine Chloride Guanidinium Chloride (G HCl)

G3PD,verGlycerin-3-phosphate dehydrogenase (G3PD)

gamma Correction,

GAPDH,verGlyceraldehyde-3-phosphate dehydrogenase Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)

Gas-Liquid Chromatography (GLC), 753

GCTGTCGATCGATTCGATCGCTAGA (oligonucleotide sequence), 794

DNA,verGenetic DNA (gDNA)

Gelatin, 615–616

yellow, 466

box, 445

documentation

devices, 453

system, 453

Filtration, 254

loading strategy for differential visualization of mRNA,

cleaning, 588

Coloring Possibilities, 436–444

Acridinnaranja, 442

Ethidiobromide, 436–438

Ice Star, 441

Methylene blue, 442–444

Silver stain, 441–442

SYBR-Oro, 440–441

SYBR Verde, 438-440

SYBR-insurance, 441

gen, 24

Reinforcements, 496

Explosion, 692–694

Cloning Method, 272-273

Reports, 643–644

CRISPR-Cas9 gene silencing mechanism,

exclusions, 496

Reproduction, 396-397

Edition, 672

CRISPR-Cas9 mechanism by,

System, 402–404

gene-specific primers, 232-233

Identification Process, 653–654

surcharge, 375

levels of genetic regulation,

Organization Affects Transcription, 19–24

rearrangements, 496

Redundancy, 396-397

Transfer, 750

gene expression, 774

analysis techniques,

Essential Questions, 652–663

miRNA as a key regulator, 369-370

Differential mRNA Screen, 664-673

Pros and cons of differential visualization of mRNA,

gel loading strategy for differential visualization of mRNA,

general procedure for differential imaging of mRNA,

differential display of mRNA,

non-subtractive methods, 663-673

Justification, 651–652

subtrative methods, 653

Subtractive Hybridization Suppression, 653-661

Adapter-linked cDNA tester for hybridization and PCR,

PCR-Select cDNA-Subtraktionssystem,

Subtractions-Exclusions-PCR,

subtraction Suppression Method,

Deleções-PCR,

Troubleshooting, 673-676

Gene Expression Omnibus (GEO), 629

chip the gen,

Generic Tube Removal Method, 545–547

Genetic diversity, 745

Genetic Information, 679

genetic Mapping,

Genetic Snapshot, 636

Genoma Reference Consortium Human Build 38 (GRCh38), 682

Genome Workbench Shipping Assistant, 691–692

Genome wide association studies (GWAS),

Genome, 843–845

examples of genomic classifications,

information, 679

Organization Affects Transcription, 19–24

Physiology, 679

Genetic DNA (gDNA), 666

Microarranjos, 632

Model molecules, 320-321

Genomics, 843-845

Mild hypotonic lysis, isolation of cytoplasmic RNA by, 87-93

soft lysis plugs, 86-87

Gentle Lysis Methods, 95

GEO,verGene Expressions-All (GEO)

GIF,verGraphics Interchange Format (GIF)

Glassware, 59–60

glc,verGas-Liquid Chromatography (GLC)

Global Analysis, 744

of gene expression, 636

Global Biomarker Market, 731–732

Global Tail Sequencing (GRO-seq), 716-717

Global Sequencing, 654

Global Transcriptome Sequencing, 202

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 264

Glycerin, 659–661

memory buffer, 585

Glycerol-3-phosphate dehydrogenase (G3PD), 282

Glycogen, 129-130

glycoma,

Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 322

Glioxal, 423

deionization, 818

Electrophoresis, 488

Yellow

RNA transfer, 483

TurboBlotter downlink, 486

Glyoxal/dimethylsulfoxide (DMSO), 417–418

Denaturation, 422-425

Sample Preparation and Gels, 424–425

standard nomenclature for referring to gel wells,

Protocol, 423-424

Glyoxalated Nucleic Acids, 423

glyoxalation

Judgment, 422-423

RNA, 423-424

Goldberg-Hogness-Box, 16–17

gnp,verGuanine nucleotides (GpN)

Graphics Interchange Format (GIF), 462

Grayscale Image Analysis, 460

Proteins marked in green, 849

Green Fluorescent Streptavidin, 633-634

Grind frozen tissue in liquid nitrogen, 176

ARNg,verARN leit (ARNg)

GRO-seq,verGlobal Continuous Sequencing (GRO-seq)

gtasa,verGuanililtransferasa (GTasa)

AGB,verGuanidintiocianato Guanidínioisotiocianato Guanidíniotiocianato (GTC)

GU-Dinucleotides, 21–22

regra GU-AG, 21-22

Guanidine hydrochloride (G HCl), 64–65

Guanidintiocianato (GTC), 838

Guanidinium puffer, 178–179

RNA isolation with, 94-95

Guanidinium Chloride (G HCl), 77–78

Guanidínioisotiocianato (GTC), 285

Guanidínio-Lysepuffer, 661

know guanidinium, 77-78

Guanidiniotiocianato (GTC), 592

Acid-Phenol Method GTC, 93-94

Guanidinium Acid Phenol Extraction, 672-673

Guanidinium Lysis Buffers, 94-95

Guanidinium acid phenolic extraction techniques, 95-98

Protocol, 97-98

Guan (G), 501

guanine and cytosine (G:::C), 75

Guanine nucleotides (GpN), 553

Guanos, 184–185

Guanililtransferasa (GTasa), 30

Gubler and Hoffman Method, 214

Lead ARN (ARNg), 403

GWAS,verGenome Wide Association Studies (GWAS)

h3k9,verHiston 3 Lisina 9 (H3K9)

Forks, 362–364

portable motorized homogenizer,

Handling of filtering membranes, 535

Hapten-tagged nucleotides, 506

Chaotropic Aggressive, 77–78

Cell Harvest and Cell Nuclei Preparation, 582-583

heat denaturation, 205

Heat Map, 635–636

with hierarchical clustering of genes,

Thermolabile probe molecules, 504

Heat Map-Matrix, 635

Hemacytometer, 583

Heparin, 154–156

Heparinjodacetato, 58

Gen, 726

Herceptin, 726

Heterocromatina, 377

Heterogeneous nuclear ribonucleoprotein (hnRNP) complexes, 21

Heterogeneous Kern RNA (hnRNA), 93

splicing efficiency, 571

heterogeneous probe, 505

Heterogeneous RNA Probes, 588-589

HGPRT,verHipoxantinguaninfosforribosiltransferasa (HGPRT)

Hierarchy Grouping, 635–636

high frequency transcripts,

high frequency mRNA, 121-122

High Performance Liquid Chromatography (HPLC), 736

high quality RNA, 135

High Performance Tools, 630-631

Higher-order three-dimensional convolution, 8–9

Histochemical stain Sudan Black B, 611

Histon 3 Lisina 9 (H3K9), 375

Histon-Deacetylierung, 370

histopathology,

HIV-RT,verHuman Immunodeficiency Virus (HIV RT) RT

ARNhn,verHeterogeneous Kern RNA (hnRNA)

hnRNP,verHeterogeneous nuclear ribonucleoprotein (hnRNP) complexes

Hogness-Box, 16–17

Homogenization, 179-180

Methods, 137-142

BeadBeater Homogenization, 141-142

Dounce Homogenization, 140-141

motorized homogenizers, 138-139

woven with the LiCl-urea method,

Opposite Competitor, 325-326

Homologous sequences, 699

Homology, 697-698

Homopolymer tail, 272-273

Hormone-Associated Malignancies, 717-718

Meerrettichperoxidasa (HRP), 611

Hot borate, RNA isolation from plant tissue using, 176-178

hot Start Nucleotides,

Hot-Start-PCR, 259–260

hot Start Nucleotides,

Haushaltsgene, 613–614

cleaning miRs, 737

HPLC,verHigh Performance Liquid Chromatography (HPLC)

hpi,verHuman placental ribonuclease inhibitor (hPRI)

HPRT,verHipoxantina-Guanosina-Fosforribosiltransferasa (HPRT)

HOUR,verMeerrettichperoxidasa (HRP)

Human chromosomal DNA, 732

Human Genome Project, 679

Human immunodeficiency virus RT (HIV RT), 208

Human Metabolism Database, 736

Human placental ribonuclease inhibitor (hPRI), 56

Hybrid molecules, 550-551

hybridization, 652

essays, 578

puffer fish, 838

Cocktail, 503–504

kinetics, 559

Influencing factors and duplex stability, 497-505

Formamide, 504

G+C content, 501

ionic strength, 500

Disagree, 502–503

pH, 500

Probe Complexity, 503

Probe Concentration, 501

Probe length, 500-501

TM recitals, 498-500

Harnstoff, 504–505

Viscosity, 503-504

Parameter, 558–559

RNA preparation for, 589-590

probes, 497

Processes, 610-612

enhancement of tyramine fluorochrome ISH signal,

process, 71

reactions, 654

reagents, 504

Recipe and parameters, 473

signs, 473

Solution, 495

strict, 568

technique, 71

Temperature, 502–503

Hybrid lenses, 645

hydrogen bonds, 501

hydrogen peroxide 534

Hydroxyapatite, 651–652

8-Hydroxyquinoline, 66

Hypotonic Lysis, 571–572

puffer fish, 581

Hipoxantinguaninfosforribosiltransferasa (HGPRT), 322

Hipoxantina-Guanosina-Fosforribosiltransferasa (HPRT), 265

IGEPAL CA-630, 581

image analysis

Considerations, 345.

software, 464

Systems, 464

image class, 457

Image Enhancement, 457–460

immobilization

method, 473

of Nucleic Acids, 475-476

Techniques, 488–491

bake, 489

Crosslinking by UV radiation, 489-491

UV cross-linking RNA to nylon filter, 491

Labeling of immunochemical probes, 603

Immunochemistry, 611

in situ hybridization (ISH),

performed on fresh tissue of the central nervous system,

for success, 623-625

in vitro

method to produce shRNA,

transcript, 558

of genes, 18

specific RNAs, 2

translation

of purified mRNA, 2

sample capacity to support, 200

In vivo transcription model for shRNA production,

Gel Autoradiography, 549-550

inaccessible RNA, 260

incubation, 568

Individual clones, 659-661

(Video) DNA Structure and Replication: Crash Course Biology #10

Induced pluripotent stem cells (iPSCs), 768

fluorescent label, 629

Informasom, 43–44

siRNA infusion, 390–391

Initiation (transcription phase), 24-26

Region of onset (INR), 16–17

Integrated Optical Density (IOD), 454-455

Intensifying Screens, 537-539

Interposer-Based Detection, 311

Internal Controls, Quantitative Polymerase Chain Reaction Techniques, 322

Internal Ribosome Entry Site (IRES), 359–360

Internal Size Standards, 427

International Nucleotide Sequence Database Collaboration (INSDC), 691–692

Altered Genes, 843-844

Intramolecular Base Pairing, 362-364

Intramolecular base pairing requires RNA denaturation, 416-418

molecular structure of common RNA denaturants,

intron removal process, 23

intron retention, 42

Intron-circRNA (ciRNA), 359

Intrones, 21–22

iodine,verIntegrated Optical Density (IOD)

ionic strength, 500

iPSC,verInduced Pluripotent Stem Cells (iPSCs)

ires,verInternal ribosome entry site (IRES)

ISH,verIn situ hybridization (ISH)

Alcohol isoamílico, 587

isolate RNA, 565

Isolated DNA sequences, 672

Isolated nuclei, 578

Isolation of cytoplasmic RNA

for mild hypotonic lysis, 87-93

Extraction Buffer Preparation, 87–90

RNA isolation, 90-93

in the silica column, 84-85

High-quality RNA isolation, 641

Prokaryotic RNA Isolation, 112-114

RNA isolation, 473

and DNA from the same source, 107-111

with guanidinium plugs, 94-95

Protocol, 108-111

DNA recovery, 110-111

RNA recovery, 109-110

of leaven, 114-116

isopropanol, 592

Ysop oral, 237

Isopinic centrifugation, 98-99

Isopycnic Separation, 93

Isopycnic technique, 826–827

Sucrose isosmotic buffer, 583-584

isotope decay data,

Isotope Labelling, 519-522

Isotopic Labeling Methods, 496

Johnson & Johnson Vaccine, 760–761

Joint Photographic Experts Group (JPEG), 462

jpeg,verJoint Photographic Experts Group (JPEG)

Kinetics of prokaryotic gene expression, 20

Kit Technology, 82–83

Lab on a Chip, 632

Label Embedding, 600

labeling system

Isotope Labelling, 519-522

Popular Non-Isotopic Platforms, 515–519

Biotin, 516–518

of Digoxygen, 518

direct labeling of enzymes, 516

Fluorescein, 519

Probe Cleaning and Storage, 522–523

Selection of, 513-523

from transcripts, 585-588

ubiquitous dyes Cy3 and Cy5, 514-515

Laboratory Procedures, 799

Laboratory Records, 791

LakOperon, 19–20

LIGHTBULB,verLoop-mediated isothermal amplification (LAMP)

Large intergenic noncoding RNA (lincRNA), 734

Image side, 467

Latent RNAse, 54–55

Pollution Problems, 54–55

detection of latent RNase activity,

general strategies for the control of RNase,

LB Funds,verLuria-Bertani-Medium (LB-Medium)

LCR,verLigase chain reaction (LCR)

Führerver Also5' Untranslated Region (5' UTR)

Gel "leading edge", 804

Blatt, RNA isolation from, 169-171

Lentivirus, 387–389

Library extension, 709

LiCl-urea method for the isolation of tissue RNA, 147–151

Tissue homogenization using the LiCl-urea method,

tapas,verLithium dodecyl sulfate (LiDS)

Ligands, 126-128

Ligase Chain Reaction (LCR), 292-293

Bound, 218–220

enzymes used, 220-221

reactions, 83

lincARN,verLarge intergenic noncoding RNA (lincRNA)

Linear Amplification Methods, 709

Linear Constraint Fragment, 581

Linear RNA Amplification, 290–291

Eberwine linear amplification process,

Linscott's Directory of Immunological and Biological Reagents, 778

lipid monolayer, 763-765

Lipid Nanoparticles, 763-765

Lipid-enriched tissue, RNA isolation from, 151-152

Samples with high lipid content, 611

Lipofection, 389–390

Lipopolisacarideo (LPS), 397

Liposomes, 763-765

liquid biopsies, 730

Liquid Chromatography, 753

liquid nitrogen, 581

Lithium dodecyl sulfate (LiDS), 77-78

LNA,verLocked Nucleic Acid (LNA)

ARNlnc,verlong non-coding RNA (lncRNA)

Load Pad, 445

for agarose electrophoresis, 838-839

Closed Nucleic Acid (LNA), 749

Effect of LNA on oligonucleotides,

Oligonucleotides Containing LNA, 261-262

long dsRNA, 386

long non-coding RNA (lncRNA),

interaction,

long-range PCR,

enhanced PCR amplification using enzyme mixes,

Long Range Technology, 278–279

Long-Term Storage of Purified RNA, 118-119

Loop Mediated Isothermal Amplification (LAMP), 293

RT-LAMP test,

display Of,

low frequency mRNA, 28-29

low frequency transcripts,

LPS,verLipopolisacarídeo (LPS)

Lumigen, 530-531

luminol,

Agriculture Luria-Medium (LB Medium), 838

lyophilization

of plums before processing the fruit,

Judgment, 173–176

Lisepuffer, 79

Formulations, 86–94

Chaotropic lysis buffer, 93-94

soft lysis plugs, 86-87

Protocol, 87-93

METRO

mak,verMonoclonal antibody (mAb)

Macromatriz, 634–635

Macromolecules, 801

Magnetic Bead Technology for Cleaning, 126-129

Magnetic Field, 753

conventional methods, 612

MALDI-TOF analysis,verMatrix-Assisted Laser Desorption Ionization Time-of-Flight Analysis (MALDI-TOF Analysis)

Mammalian Cells, siRNA Delivery Methods in, 389–391

mammalian RNA, 191-192

Manifestation kryptischer Introns, 42

Marmur Equation, 501

Mass Spectrometry (MS), 753

Mass to moles, conversion from 793 to 796

Material Safety Data Sheet (MSDS), 787

Matrices, 129

Configurations, 130–131

Matrix-Assisted Laser Desorption Ionization Time-of-Flight Analysis (MALDI-TOF), 850

Mature eukaryotic mRNA molecules, 29-30

mature plant cells, 164

Mature RNA Molecules, 43-44

MCS,verMultiple Cloning Site (MCS)

Melting Curve Analysis, 317-318

real-time polymerase chain reaction, and

merger process, 71

Melting point 73-74

membrane, 473

Membrane-Bound Gene-Specific Probes, 572-573

membrane RNAbundene, 549

Membrane Integrated Receptors, 759

β-mercaptoethanol (β-ME), 94

MERS,verMiddle East Respiratory Syndrome (MERS)

MERS-CoV,verMiddle East respiratory syndrome coronavirus (MERS-CoV)

Messenger-ribonucleoprotein (mRNP), 416-417

ARN the Boats (ARNm), 185–186

Biogenesis,

Comparison of transcription and translation in prokaryotic and eukaryotic cells,

complementary, 555–558

Components, 651–652

difference Screen,

Pros and cons of differential visualization of mRNA,

gel loading strategy for differential visualization of mRNA,

general procedure for differential imaging of mRNA,

epigenetic Modifications,

Fraction, 34-35

methylation, 687-688

modifications, 686

Molecules, 416-417

Protein encoded by mRNA, 732

Arrangement, 769–772

Substitution therapy, 765

selection process, 121

Sequence and structure affect translation, 40-42

alternative splicing of messenger ribonucleic acid from a single gene locus, 42

species, 571

Surveillance Procedures, 762-763

metabolic disorders, 765

Metaboloma, 753

Metabolism, 736

Measurement Methods, 753

Metabolomic Workbench, 736

metagenomics,

Metanol (MeOH), 617

Methionine (Met), 241

Methylcellulose, 606-608

methylation, 28

Methylene blue, 442–444

7-Methylguanosine 687

Metrizamide, 98–99

MGB,verMinor Groove Binder (MGB)

Micromatrices, 644-646

Antibody, 850-851

Applications, 646–648

Low-sensitivity, high-throughput arrays for real-time PCR,

human phosphorus receptor tyrosine kinase antibody arrays,

expression data, 629

Heat Map, 635–636

hybridization, 643

Reference RNA, 643-644

Scatterplot analysis compares two sets of data,

Screening, 659-661

Technology, 636

Microcentrifugation, 592

Microfluidics, 632

Microcentrifuge Tubes, 606-608

Micrograms to OD (μg/OD), 249–250

Microinjection, 391

Gene Expression Micromanager, 361

MicroARN (miARN), 759

Biogenesis, 572–573

Example miRNA entry in miRBase,

miRNA-nomenclature,

regulatory processes for miRNA,

Biomarker, 727-730

variety of biomarkers,

miRNAs and disease detection,

comparative biogenesis of miRNA and siRNA,

Comparison of siRNA and miRNA,

Gen, 362–364

isolation, 116

as a key regulator of gene expression, 369-370

Profiled, 368–369

ordinance, 571

Samensequenz, 365

structural and functional properties, 361-362

miRNA and ncRNA resources,

Slides, 606-608

Microscopically Dissected Tissue, 640–641

Middle East Respiratory Syndrome (MERS),

Middle East respiratory syndrome coronavirus (MERS-CoV),

Milestone Techniques, 684

Minor Groove Binder (MGB), 314

MIQE Directives, 305-307

miRbase, 362

miARN,vermicroARN (miARN)

miRNA response elements (MREs), 33

my name,

Outliers, 72–73

Discordant, 502–503

mitochondria, 603

Mitochondrial chromosomes, 683

Mitochondrial DNA (mtDNA), 35

mitochondrial mRNA, 35

Mitochondrial rRNA, 705-708

Mixed Phase Hybridization, 523-527

Prehybridization, 523-524

Probe hybridization, 524-527

Mixer, 261–262

MMLV RT,verMoloney murine leukemia virus (MMLV) RT

modern mRNAs, 761-762

Modern Vaccines, 760–761

MODÔMIC, 686

Molenbruch, 499–500

molecular beacons,

Molecular Biology, 495

hybridization, 697

work, 824

Techniques, 745–753

Tool, 603-604

Molecular Biomarkers, 731-732

Molecular Interaction Database, 850–851

Molecular Methods, 605–606

Pasta Molecular, 220

molecular scissors, 220

Molecular Weight Standards, Proper Use, 426–428

Moloney murine leukemia virus (MMLV) RT, 208

monomethylol groups 147

Monocistronic, 20

Monoclonal Antibody (mAb), 646-648

Monovalent cations, 500

MOPS-Puffer, 839

Ten Element Motif (MTE), 16–17

Motorized Homogenizers, 138–139

motorized portable homogenizer,

Polytron-Homogeneizador,

MRE,vermiRNA response elements (MREs)

mRNA,verBoten-ARN (ARNm)

RNPm,vermessenger ribonucleoprotein (mRNP)

EM,verMass spectrometry (MS)

safety data sheets,verMaterial Safety Data Sheet (MSDS)

ADNmt,verMitochondrial DNA (mtDNA)

MTE,verMotif Ten Elements (TEM)

Multiomics, 738

Resources,

Multiple Cloning Site (MCS), 286

Multiple real-time PCR platforms, 305

Multiple TATA boxes, 282

multiple copy gene,

Multiple Structure Devices, 635

Multiplex-PCR, 325

First Multiplex Project, 250-251

mutations, 698

Mycoplasma contamination, 641

norte

805

N-hidroxisuccinimidaster, 642

192–193

Methyl 2-aminoethanesulfonic acid solution (TES solution), 589

Triphosphate 576

687

Nanobiotechnology, 749–750

NanoDrop Spectral Photometer, 186

Nanofabrication, 749-750

Vapor de nanomoles OD (nmol/OD), 249-250

Nanotechnological type devices, 390

NaOH, 839

TO TAKE,verNucleic Acid Sequence Based Amplification (NASBA)

Nascent RNA Molecules, 573–576

National Center for Biotechnology Information (NCBI), 751

buffer preparation,

NBT,verNitroblau-Tetrazólio (NBT)

NCBI,verNational Center for Biotechnology Information (NCBI)

ARNNC,vernon-coding RNA (ncRNA)

Near Infrared Fluorescence Detection (NIR Fluorescence Detection), 465

Negative Control Considerations

portable polymerase chain reaction workstation,

Quantitative Polymerase Chain Reaction Techniques, 329-330

Nested PCR, 275-276

nested primers,

Neurodegeneration, 717-718

Neurons, 387–389

New gene discovery, 661

Next Generation Sequencing (NGS), 844

An RNA-seq platform,

Systems, 702-703

nfq,verNon-fluorescent eraser (NFQ)

SNG,verNext Generation Sequencing (NGS)

NHK,verNormal human keratinocytes (NHK)

Translation of Nick, 508

NIR fluorescence detection,verNear-infrared fluorescence detection (NIR fluorescence detection)

Nitroblaues tetrazolio (NBT), 611

Nitrocellulose, 588–589

Filter connection, 688

nitrogen, 7-8

nitrogenous bases, 7

Nmd,verNonsense Impairment (NMD)

magnetic resonance,verNuclear Magnetic Resonance (NMR)

method without PCR,

for confirmation of PCR-derived data, 270-271

Reverse North Analysis,

Non-tadenylated histone-mRNA, 34-35

Non-canonical base pairs, 71

Non-coding RNA (ncRNA), 733

circARN, 358–361

Classification of non-coding RNAs in typical mammalian cells.

examples of,

ARNlinc, 356-357

lncRNA, 355-356

sncRNA, 355

Y-RNA, 357-358

Transcripts without coding, 723

Columnless Purification, 132-133

Nondenaturing Agarose Electrophoresis, 194-195

Non-denaturing aqueous buffer, 81

Nondenaturing Gels, RNA Analysis, 425-435

Non-fluorescent eraser (NFQ), 312-314

Hybridization not based on formamide, 504

Non-complete Oligonucleotides, 197-198

non-peer competitor, 336

Synthesis of, 338-340

Noidet P-40 (NP-40), 77-78

ARN-Lysepuffer, 839

Non-ionic detergents, 86

Nonionic Lysis, 81-82

Blower, 86–87

Non-isotopic Labeling, 565-568

nonisotopic markers,

Nonisotope Methods, 528–534

chromogenic detection methods, 534

Chemiluminescence Detection, 529-533

Nonisotopic Systems, 496

nonmolecular physiological indicators,

Nonsense Intermediate Impairment (NMD), 38

Nonspecific Inhibitors, 58

Nonspectrophotometric Methods, 190–191

determination of sample mass and molecular weight,

Non-Subtractive Methods, 663–673

normal human keratinocytes (NHK),

Normalization with Poly(T) probe, 413-416

hybridization, 415

Post-hybridization washes, 415–416

Prehybridization, 413-414

buffer preparation,

sample preparation, 413

Synthesis of poly(T) probe, 415

northern Analysis,

Choice of membrane transfer, 474-477

Membrane Handling and Preparation, 477–478

Immobilization Techniques, 488–491

Northern Transmission Techniques, 478–488

alkalisches Blotting, 482–483

Hair transfer, 478-480

Electrotransferencia, 482

RNA Transfer by Passive Capillary Diffusion, 483-485

TurboBlotter RNA Downblot, 486-488

void stain, 480-481

Manipulation of Absorption Membranes After Fixation, 491-492

Reverse North Analysis, 492-493

Northern Transfers, 523–527

No tan accidental (NSR), 707-708

ANP,verNuclease Protection Assays (NPA)

Ensaio NRO,verNuklearer Run-on-Assay (NRO-Assay)

NSR,verNot So Random (NSR)

PNT, 4–5

Nuclear expression of cellular oncogenes as a function of cell shape,

Basic Integrity, 583–584

nuclear Isolation,

Nuclear Magnetic Resonance (NMR), 736

RNA core, 77–78

Alternative Method for Nuclear Bleed Tests, 591-592

direct isolation of, 597-598

Distinguishing between RNA polymerase activities, 595-596

Nuclear RNA Extraction for Steady State Analysis, 596–597

nuclear test, 582-591

Alternative protocol for preparing cell nuclei from cell cultures, 583–584

Alternative Protocol to Prepare Cell Nuclei from Whole Tissue, 584-585

Cell Harvest and Cell Nuclei Preparation, 582-583

Transcript Labeling and Retrieval, 585-588

Post-hybridization Washing and Detection, 590-591

RNA preparation for hybridization, 589-590

Target DNA Preparation, 588-589

Nuclease Protection Tag Transcription Assay, 593–595

Nuclear RNA Preparation from Ribonuclease-Enriched Cells, 598-599

Justification, 571;

Transcription Rate Assays, 571-582

nuclear run-off versus nuclear run-on test, 581-582

Relationship to Steady-State RNA Study, 579-581

Error Correction in Nuclear RNA Analysis, 599-600

Kernabfluss Essay, 581–582

Nuklearer Run-On-Assay (NRO-Assay), 582–591

alternative procedure for, 591-592

Alternative protocol for the preparation of cell nuclei

Cell Cultivation, 583-584

Whole cloth, 584-585

contemporary,

Cell Harvest and Cell Nuclei Preparation, 582-583

Transcript Labeling and Retrieval, 585-588

Post-hybridization Washing and Detection, 590-591

RNA preparation for hybridization, 589-590

Target DNA Preparation, 588-589

traditional,

using normal human keratinocytes,

nuclear transcription assays,

nucleasa,

Nuclease activity, compounds used for control, 64-68

Nuclease degradation, 554-555

Nucleaseverdau, 553

Nuclease Protection, 571

Analysis, 554-555

basic approach, 549-554

Optimization Tips, 558–559

possible difficulties, 559-561

Probe Selection, 554–558

RNasa A y RNasa T1,

S1 and RNase protection assays,

Ten micrograms of different total RNAs from mouse tissue were hybridized,

Pulselabel Transcript Essay, 593-595

Justification, 549

Transcription quantification by

RNase Protection, 565-568

S1-Analysis, 561–565

Troubleshooting, 568-569

Nuclease Protection Assays (NPAs),

and nuclear transcription assays,

Nucleasa S1, 552-553

nuclease free water, 81

Nuclease-resistant double-stranded hybrids, 593-595

Core, 572–573

Harvest and Preparation Cells, 582-583

Nucleic Acid Probe Technology, 625

DNA Probe Synthesis, 505-509

DNA 3' end tag, 509

DNA 5' end tag, 508-509

Translation of Nick, 508

Polymerase Chain Reaction, 507-508

random initiation, 508

Factors Affecting Hybridization Kinetics and Duplex Stability, 497-505

Formamide, 504

G+C content, 501

ionic strength, 500

Disagree, 502–503

pH, 500

Probe Complexity, 503

Probe Concentration, 501

Probe length, 500-501

Reflections, 498–500

Harnstoff, 504–505

Viscosity, 503-504

generic tube removal procedure

Mixed Phase Hybridization, 523-527

Prehybridization, 523-524

Probe hybridization, 524-527

Principles of Recognition, 527–545

Autoradiography, 542-545

Reflections on Autoradiography, 534–542

nonisotopic methods, 528-534

Phosphor Imaging and Digital Detection Systems, 527–528

Justification, 495–496

probe labeling strategies,

Choice of Marking System, 513–523

Isotope Labelling, 519-522

Popular Non-Isotopic Platforms, 515–519

Probe Cleaning and Storage, 522–523

ubiquitous dyes Cy3 and Cy5, 514-515

Antisense and Sense RNA Probe Synthesis, 509-513

RNA 3' end tag, 513

RNA 5' end tag, 513

In Vitro Transcription, 512-513

Nucleic Acid Sequence Based Amplification (NASBA), 292

nucleic acids, 819

analog, 260

children, 474

concentration, 183-184

Determination of, 184-186

Sample Normalization, 410-411

information, 807

Determination of Nucleic Acid Purity, 187-189

key indicators,

Duplex, 500

Immobilization of, 475-476

A membrane, 474

Microarranjo, 629

Molecules, 807

Nucleic Acid-Based Subtraction, 653

as medicine, 759-772

RNA-Biobancos, 766-767

RNA Innovations, 772

RNA Reprogramming, 768-769

Vaccines and RNA Therapeutics, 760-766

Trans-Spleißen, 769–772

Polymerization, 5-6

probes, 496

concentrations,

sequences, 784

stains, 436

Transmission, 482

Nucleocytoplasmic Transport, 773-774

Nucleosides, 2–3

Adenosine Nucleoside, 184-185

Nucleotide BLAST (BLASTn), pp. 692-693

Nucleotides (nt), 699-700

Cocktail, 641–642

Nucleotides 2–8, 392

Kern, 1

Nylon, 475–476

Absorption membranes, 568

Macromatrices, 634–635

A membrane, 489

Nylon 66, 475

UV cross-linking RNA to nylon filter, 491

OKT4,verOctomer-binding transcription factor 4 (OCT4)

Octomer-binding transcription factor 4 (OCT4), 769

OUTSIDE,verOptical Density (OD)

Ohm's Law, 802

Oligo(dT), 205

Affinity Chromatography, 129-133

column, 129

Oligo dT-Barcode-Primer, 715

Oligo(dT) agarose balls, 129

Oligo(dT)-cellulose, 131

Oligo(dT) templates, 124-125

Poly(A)+ RNA purified by oligo(dT), 431-432

232–233

Initiation, 206

Oligomer, 499

oligonucleotides, 700

Microarranjos, 634

probes

synthesis scales,

Omik,

Oncomires, 370

OncotypeDX, 737–738

PCR unilateral, 272-273

OOAC device,verOrgan-on-a-Chip device (OAC device)

Open Reading Frames (ORFs), 843-844

Optical Density (OD), 459

(Video) ISEV Rigor and Standardization on current EV methods usage and needs: Nieuwland, Falcon, and Witwer

improvement,

Electroforetogramas, 468-472

set, 255

Suggestions, 558–559

ORF,verOpen Reading Frames (ORFs)

Organ-on-a-Chip device (OAC device),

Messenger Organellar Ribonucleic Acids, 35

Organic solvents, 499

Organs and Tissues, RNA Isolation Strategies for Various, 142–156

PAG

(PAB-cellulose), 153

PAB-cellulose,ver(PAB-Cellulose)

PABP,verPolyadenylate binding protein (PABP)

PABP,verPoly(A) binding proteins (PABP)

BOOK PAGE,verPolyacrylamide gel electrophoresis (PAGE)

matched project, 644

PAM,verProtoespaciador Benachbartes Motiv (PAM)

Pangenome, 683

Pangenomik,

Paraffin Embedded Tissue, 606

Paraformaldehyde, 609-610

Paraformaldehydlösung (PBS), 619

PARIS,verPsoralen Analysis of RNA Structures and Interactions (PARIS)

Partitioning of cDNA template molecules, 320-321

Easter, 381

Passive capillary diffusion, RNA blotting, 483-485

Passive capillary transfer method, 478-479

pathogens, 496

PBG,verPorphobilibogenio-Deaminase (PBGD)

PBS,verParaformaldehyde solution Phosphate buffered saline (PBS) solution

pci,verPhenol: chloroform: isoamyl alcohol (PCI)

PCR,verPolymerase Chain Reaction (PCR)

CONNECTION,verPolietilenglicol (PEG)

Pentoses, 4

Permeabilization, 605-606

Pfizer-BioNTech-ARNm,

pH, 500

Effect of pH on rigor, 75

Ghost Gang, 226

Pharmacogenomics, 767

Phenol, 178-179

Phenol: chloroform: isoamyl alcohol (PCI), 65–66

Phenotype, 743-744

Phosphate blower, 839–840

Phosphate group, 2–3

de α-fosfato, 4-5

of β-phosphate, 4-5

γ-phosphate, 4-5

Phosphate Buffered Saline (PBS), 839

Phosphodiester, 553

Phosphorimaging-Systeme, 549–550

Photoactivatable Ribonucleoside Enhanced Crosslinking and Immunoprecipitation (PAR-CLIP), 154

Photographic documentation, 645.

biomolecular imagers, 465

Camera Settings, 466–467

Digital Image Analysis, 454–465

Filtration, 460-461

common electrophoretic stains and color matching filters,

Image Enhancement, 457–460

Image formats, 462

Inherent Limitations of X-ray and Photographic Film, 467-468

practical considerations, 462-464

Security, 453–454

Tips for Optimizing Electrophoretograms, 468–472

traditional methods of, 465-468

Photographic systems, inherent limitations of, 467–468

Photolithography, 634

Photoreactive Nucleoside, 689

physiological ionic strength, 74

Pictogram (p.), 29

Elements of Image, 455–456

Piperazine-1,4-bis(2-ethanesulfonic acid) (PIPELINES), 562-563

ARNip,verPiwi Interactive RNA (piRNA)

Piwi Interactive RNA (piRNA), 378

Pixel, 455–456

bitmap,

depth, 457

values, 457

plant tissue, 163

Isolation of inactivated RNA

Hot Borate Plant Tissues, 176–178

Problem Solving, 179-180

Strategies for isolating RNA from, 178-179

Plantar

Objectives, 572-573

Types of RNA produced in, 167-169

Mauer, 164

fruit screen, 173-176

RNA isolation

and peculiarities of plants, 163–167

of the bark, 171-173

of fruits, 173–176

of the sheet, 169-171

plant tissue with hot borate, 176-178

Protocols, 179

Strategies for isolating RNA from plant tissues, 178–179

Troubleshooting RNA Isolation from Plant Tissue, 179–180

Types of RNA Produced in Plant Cells, 167-169

Plasmid, 759-760

PMI,verPrecision Medicine Initiative (PMI)

polaroid

compatible instant film, 465

dirty rollers on polaroid camera,

DS-34 Handheld Camera,

movie, 471

Poly(A) binding proteins (PABP), 123

mRNA poly, 410

Poli(A)-Anker, 272–273

Notice Poli(A), 125-126

Assay Sensitivity Considerations, 126

Considerations for cDNA synthesis, 125-126

Poly(A) content, direct measurement of, 411-416

Poli(A)-Polymerasen, 57-58

Cauda Poly(A), 205

Cleaning,

Magnetic bead technology for, 126-129

RNS,verPolyadenylated RNA (RNA)

Poly(C)-Anker, 272–273

Poli(G)-Anker, 272–273

poly(T) probe, synthesis of, 415

Poly(U)-matrix, 85

Polyacrylamide, 417

Yellow, 567–568

polyacrylamide gel electrophoresis (PAGE),

Polyadenylate binding protein (PABP), 34-35

polyadenylated molecules, 121

Choice of, 123–125

ARN de ARN polyadenylado), 129-130

Magnetic Bead Technology for Cleaning, 126-129

oligo(dT) affinity chromatography, 129-133

Protocol, 132-133

poly(A) warning, 125–126

Polyadenylation, 122-123

Selection of polyadenylated molecules, 123-125

Polyadenylation, 122-123

in prokaryotes, 39-40

polycistronic mRNAs, 40-41

Polietilenglicol (PEG), 517-518

Polymilchsäure, 763–765

Polymerase Chain Reaction (PCR), 793

ver AlsoQuantitative polymerase chain reaction (qPCR)

A-cauda of blunt PCR products, 286-287

Additions, 255

alternative transcription initiation sites, 282-283

Reinforcement, 715-716

LAMP Trial, 293–295

Ligase Chain Reaction, 292-293

RNA-amplification lineare, 290-291

Nucleic Acid Sequence-Based Amplification, 292

Tilt Circle Gain, 292

tape change gain, 291-292

cDNA amplification, 284-285

Analysis of PCR Products, 266-267

putative product identification,

matrices,

Cloning of PCR Products, 285-289

First Strand cDNA Synthesis, 283-284

ΔG considerations, 250

Guidelines, 245-248

Hot-Start-PCR, 259–260

Internal Control, 263–265

micropipette tips for,

Multiplex Primer Design, 250–251

Non-PCR Methods to Confirm PCR-Derived Data, 270–271

Optimization Methods, 251–262

Effects of CRP-enhancing additives,

locked nucleic acid, 260-262

negative controls,

oligonucleotide synthesis ladders,

positive controls, 258

Polimerasen termoestable, 256-257

PCR-based methods, 679

PCR-Select cDNA-Subtraktionssystem,

Prevention, 235-238

aerosol resistant tips, 237-238

design work,

Procedural Methods, 237

238

First-Design, 239–251

Codon usage table for degenerate primer design,

basic nomenclature,

product, 506

product stocks,

quality control points,

reaction, 246

leads to an exponential amplification of specific target sequences,

TA Cloning Ligation Reaction, 287-289

Techniques, 271–282

Long distance, concept of, 276–279

nested, 275-276

3' RACE-PCR, 275

5' RACE-PCR, 271–273

5′ RLM RACE, 273–274

Einzelzell-PCR, 279–280

Splinkerette PCR, 281–282

theoretical Exponential Gain,

Reflections, 248–250

estimate 249

Precision Calculations, 249–250

TOPO cloning procedure, 289

Tierra,

Information on Transcription Controls, 265–266

A polymerase, 6

Polymorphism, 502-503

Polynucleotide, 552-553

dinucleotide,

stereochemical preferences of purines and pyrimidines,

Summary, 5-9

Polyribonucleotides, 596

Polysomal mRNA, isolation of , 154-156

Polysome, 20

faction, 20

Purification of mRNA bound to polysomes, 152-154

Polytron, 138–139

homogenizer,

Polyvinylsulfato, 58

Polyvinylidene difluoroeto (PVDF), 477

Polyvinylsulfonic acid (PVSA), 64

Popular Non-Isotopic Platforms, 515–519

Biotin, 516–518

of Digoxygen, 518

direct labeling of enzymes, 516

Fluorescein, 519

Porphobilibogenio-Deaminase (PBGD), 265

Postgenomic era, 743

Post-hybridization, 498

Disassembly, 553

detection, 504

Fleck, 611

Ablutions, 590–591

Data Analysis After Sequencing, 709

Posttranscriptionelles Gene-Silencing (PTGS), 378

Post-transcriptional regulation, 44.

gene expression, 27

Post-translational normative facts, 687

Potassium Acetate Reagents, Rapid RNA Isolation by SDS and, 111–112

power supply, 446

verDehydrin 2-Gen

Pre-miRNA Transcription, 364-365

Precision Medicine Initiative (PMI), 766–767

progenitor cells, 653

Pre-cut filters, 480

Preflash Blade, 539

Prehybridization, 523-524

preliminary analysis of gene expression,

premature termination codons, 38

Pri-miARN, 381

Pribnow Box, 15–16

Pribnow-Schaller-Box, 15–16

Primary Reinforcement, 341-343

primary cell wall, 164

Primer3Plus, 239

Primaries, 325–329

Gloss, 228–229

Borrador, 239–251

Extension, 229

probe(n),

Complexity, 503

concentration, 501

generic tube removal method, 545–547

Hybrids, 558–559

qualification

method, 473

strategies,

Largo, 500–501

Probe-Based Detection, 312-314

cleaning

and Storage, 522–523

system, 565

Renaturation, 554–555

Selection, 554–558

RNasa A y RNasa T1,

S1 and RNase protection assays,

Ten micrograms of different total RNAs from mouse tissue were hybridized,

forecast, 726

Prokaryotes, 381

Prokaryotischer CRISPR-Array-Locus,

prokaryotic RNA

Isolation of, 112-114

phenomenon, 40

Proliferation Controls, 728

proliferation phenotype,

Organizers, 14-19

property, 67

specific prostate antigen, 725

Proteaseverdau, 146

Protected Fragments, 549–550

Proteinase, 605-606

proteins, 846

lines, 753

Tokens, 753

Expression Dates, 680–681

Hydrolysis, 605-606

Methods, 399–400

Microarranjos, 629

Protein-Protein Interaction Databases, 850-851

Purification of mRNA bound to proteins, 152-154

RNsi, 56

Sequence Information, 497-498

Proteomas, 846-851

propensity to fold amino acids,

Matrices, 646–648

Proteomics, 846–851

Databases, 851

Profiling Methods, 736

Protocol: Probe, 524-527

Protoespaciador Benachbartes Motiv (PAM), 403–404

Pseudosustrato, 57

Pseudouridina, 687

Psoralen Analysis of RNA Structures and Interactions (PARIS), 8–9

PTGS,verPost-transcriptional gene silencing (PTGS)

PubMed, 777

Pulse Centrifuge, 566-567

Pulse-Labeling-Technik, 593–595

spray, 159

cleaning

Goals in Ribonucleic Acid Purification, 78-82

of polysomes and protein-bound mRNA, 152-154

purified miRNA, 368

purified RNA, 158

short and long term storage of, 118-119

slurry (Pu),

PVDF,verPolyvinylidene difluoroeto (PVDF)

PVSA,verPolyvinylsulfonic acid (PVSA)

teacherPolymerase, 256-257

Pyrimidine (Py),

256–257

Pyruvate, 804

QA,verQuality control (QC)

qLAMP Method, 293

qPCR,verQuantitative polymerase chain reaction (qPCR)

QTL,verQuantitative trait loci (QTL)

qualitative information, 640

Quality Control (QC), 634

RNA electrophoretic profiling, 191-195

non-denaturing agarose electrophoresis, 194-195

RNA integrity number, 195-197

Sample capacity to support RT-PCR, 199-200

UV shading, 197-199

UV Spectrophotometry and Absorption Rates, 183-191

Determination of Nucleic Acid Concentration, 184-186

Determination of Nucleic Acid Purity, 187-189

non-spectrophotometric methods, 190-191

typical UV absorption profile of the purified RNA,

quantification, 497

specific RNA transcripts through nuclease protection,

Quantitative Approaches, 833

Quantitative data, 596

Quantitative Polymerase Chain Reaction (qPCR), 307

ver AlsoPolymerase Chain Reaction (PCR)

alternative approach, 338-345

competitive polymerase chain reaction, 338-345

Image Analysis Considerations, 345

competitive polymerase chain reaction, 336-337

Control Reaction Formats, 325-328

digitalis polymerase chain reaction, 318-321

exogenous controls, 323-324

Internal Control, 322

Melting Curve Analysis, 317-318

MIQE Directives, 305-307

Negative Control Considerations, 329–330

polymerase chain reaction matrices, 330

quantitative approaches, 303-305

Real Time Polymerase Chain Reaction, 307-311

Platforms, 311-316

Sensitivity index, 302-303

Problem Solving Quantitative Polymerase Chain Reaction Techniques, 345–348

Quantitative profile, 697

Quantitative trait loci (QTL), 701

Dormant cells, 653

Chinone, 65–66

Kaninchen-Globina-RNAm, 323

Rabbit Reticulocyte Lysate, 200

CARRERA,verRapid Amplification of cDNA Ends (RACE)

Radioactive probe, 611

Radioactive waste, 566

Radiomarca, 593–595

Radiolabelled Molecules, 558

Radiolabeled PCR Products, 670-671

Random Primers, 232-233

Rapid Amplification of cDNA Ends (RACE), 271-272

Rapid Diagnostic Device, 731-732

rapid isolation,

RNA Testing with SDS and Potassium Acetate Reagents, 111-112

Rational Drug Project, 2

RBS,verRibosome binding sites (RBS)

Cinch,verRolling Circle Gain (RCA)

FCR,verRelative Centrifugal Force (RCF)

rddm,verRibonucleic acid-directed DNA methylation (RdDM)

RdRP,verRibonucleic acid-dependent RNA polymerases (RdRPs)

Real-Time Competitor Polymerase Chain Reaction, 338-345

Real-time polymerase chain reaction (RT-PCR), 751

ver AlsoCompetitive polymerase chain Digital polymerase chain reaction

Approximations, 399

Comparison of PCR platforms,

format, 311

and analysis of the melting curve,

platforms

Molecular Beacons, 314–316

scorpions, 316

SYBR Green Essay, 311–312

Essay, 312–314

quality control points,

sample capacity to be compatible, 199-200

transcript quantification,

Real Time Systems, 310-311

Records, 789–792

Transcript Retrieval, 585–588

Recycling processes, 761–762

Red Fluorescent Anti-DNP Antibodies, 633-634

REDTaq, 784

References, 263

mRNA transcripts, 322

Reference RNA, 643-644

Reference record, 264

Normative Elements, 14–19

Regulatory molecules, 759

regulatory processes for miRNA,

Relative Centrifugal Force (RCF), 821

Relative Quantification Method, 309–310

Restoration, 495

The replica, 646

Representative cDNA molecules, 231-232

Request identification number (RID number), 694

resilient ribonucleases

common sources of RNase activity,

Elimination of, 52-54

Restriction Endonuclease Digestion, 588

Restriction Enzyme, 684-685

digestion, 83

Restriction Fragment Length Polymorphism (RFLP), 679

Genoma retroviral, 217

pull back, 107

Reverse genetics, 375–376

Reverse North Analysis, 492-493

Reverse transcriptase (RT), 653

Properties of wild-type AMV and MMLV reverse transcriptase,

Reversed Phase High Performance Liquid Chromatography (Reversed Phase HPLC), 253

reverse phase HPLC,verReversed Phase High Performance Liquid Chromatography (Reversed Phase HPLC)

RFLP,verRestriction Fragment Length Polymorphism (RFLP)

RGB,verRed, Green and Blue (RGB)

RHODE ISLAND,verRibonuclease inhibitors (RI)

Ribonuklease (RNasa), 51

Cocktail, 559–560

control, 116

RNAse A, 185-186

ARNasaH, 207

RNase inhibitor, 56

Pipeta Pasteur RNaseless, 586

RNase-free plastic items, 798

RNase Free Strategies, 568

RNase-free technique, 690

Ribonuklease-Inhibitorprotein (RIP), 56

Ribonuclease Inhibitors (RIs), 56

non-specific inhibitors, 58

specific inhibitors, 56-58

RNasi, 56–57

RVD, 57–58

Types of, 55–58

Ribonuclease Protection Assay (RPA), 671-672

to quantify specific RNA species,

Transcription quantification by, 565-568

Ribonuclease Free Environment, 611

Compounds to Control Nuclease Activity, 64-68

8-Hydroxyquinoline, 66

cesium salts, 66-67

know guanidinium, 64-65

Sixty-five

Phenol: chloroform: isoamyl alcohol, 65–66

Proteinasa K, 67

PVSA, 64

Safety Data Sheet, 65

Elimination of resilient ribonucleases, 52-54

latent RNase contamination problems, 54-55

Equipment and Reagent Preparation, 58–64

hydrogen peroxide, 63

NaOH and sodium dodecyl sulfate, 63-64

Sterile Water Options, 60–63

ultraviolet light, 60

Protocol, 68-69

Types of ribonuclease inhibitors, 55-58

Ribonuclease (RNase), 77

Nuclear RNA Preparation from Spiked Cells, 598-599

Ribonucleic Acid (RNA), 781

analysis, 504

base, nucleoside and nucleotide nomenclature,

bicistronic messenger ribonucleic acids, 38-39

Biobancos, 766–767

Biogenesis, 13–14

biomarker,

Blotting-Technik, 476

Purification Methods, 157–159

comparative Nucleotide Structure,

disassembly, 66

delivery vehicles,

Denaturalizers, 417-418

Denaturation, 559–560

Density Gradient Centrifugation, 98-107

cesium chloride, 99-103

typical buoyancy density ranges of DNA, RNA, and proteins,

digestion, 800

Location Points, 833–834

Deregulation, 729-730

electrophoretic profile of, 191-195

Enrichment, 705–708

Strategies for preparing RNA-Seq libraries,

Epigenomics Database, 686

Expression Profile, 723

extraction machines, 83

Fragmentation, 705-708

The organization of genes and genomes affects transcription, 19-24

Glyoxalation and Electrophoresis von, 423-424

Goals in Ribonucleic Acid Purification, 78-82

combinations of salt and alcohol for the precipitation of nucleic acids,

Guanidinium acid phenolic extraction techniques, 95-98

Characteristics of Typical Messenger Ribonucleic Acid, 28-35

Hybrids, 604–605

nucleotide identity,

Innovations, 772

integrity, 409

Isolation of Liquid Matrices, 116–118

Isolation of RNA and DNA from the same source, 107-111

RNA isolation with guanidinium buffers, 94-95

Gene regulation levels, 43-45

Lysis Buffer Formulations, 94

Chaotropic lysis buffer, 93-94

soft lysis plugs, 86-87

Protocol, 87-93

Medicines, 759

messenger ribonucleic acid, 35-38

Sequence and structure affect translation, 40-42

Methods, 111–116

Protocol, 114-116

Molecules, 549–550

on non-denaturing gels, 425-435

of Northern Analysis, 474

Nucleoside, 3

nucleotides, 687

RCP, 223

A polymerase, 581

Distinction between activities of, 595–596

Polymerases and Transcription Products, 24-28

Polynucleotide Synthesis, 5–9

RNA preparation for hybridization, 589-590

prokaryotic messenger ribonucleic acids, 39-40

Promoters, Transcription Factors, and Regulatory Elements, 14-19

cleaning efficiency, 737

Pureza, 184-185

quality control, 200

rapid RNA isolation using SDS and potassium acetate reagents, 111–112

recognition elements, 154

Restoration of, 109–110

RNA extraction from a DNA sample, 800

reprogramming,

RNA Isolation Kits, 82-85

RNA-Based Assays for Transcript Quantification, 302

RNA-Based Experimental Design, 759

RNA CHIP Process,

RNA-chromatin, 688-690

Immunoprevention Trial, 690

RNA-Dependent DNA Polymerase, 207

RNA-Binder Interaction Database, 749

RNA-protein complexes, 22-23

RNA-protein interactions, 688-690

CLIP-Workflow,

ARN-ARN, 688-690

essays, 829

secondary structures, 417

Sequence Analysis, 697

Short- and Long-Term Storage of Purified RNA, 118–119

stability, 54

By structure, 8–9

eukaryotic RNA subpopulations,

target hybrids, 549

therapeutic, 759

strategies,

Transcription and Central Dogma, 12–14

Passive Capillary Diffusion Transmission, 483–485

Downlink TurboBlotter's, 486-488

Types of, 9–12

types and functions of ribonucleic acids,

Types of RNA Produced in Plant Cells, 167-169

Vaccines and Therapeutics, 760-766

Essential Vocabulary on COVID-19,

RNA Delivery Vehicle,

RNA therapy strategies,

RNA vaccines release functional mRNA molecules,

Vaccine mRNA structural motif,

vaccines against COVID-19,

Vaccines release functional mRNA molecules,

Ribonucleic Acid (eRNA) Amplification, 376

Ribonucleic Acid Immunoprecipitation (RIP), 707

Ribonucleic Acid In Situ Hybridization (ISH RNA), 603

Fresh Frozen Brain Tissue for ISH, 615-617

Hybridization and Detection Methods, 610-612

enhancement of tyramine fluorochrome ISH signal,

positive and negative control considerations, 613-615

Justification, 603;

RNA in situ hybridization, whole assembly for arachnid embryos, 620–623

Sample Preparation, 605–610

paraffin-embedded fixed specimens, 609-610

fresh frozen samples, 608–609

(Video) Exosomes: From pure isolation to standardized analysis by flow cytometry

In Situ Hybridization Tips for Success, 623–625

spatial transcriptomics, 623

technical considerations, 603-605

Pros and cons of in situ hybridization,

an in situ hybridization method,

complete assembly for arachnid embryos, 620-623

for zebrafish embryos, 617-620

Ribonucleic Acid Integrity Number (RIN), 705

Verification of RNA integrity on the Bioanalyzer microfluidic chip,

Ribonucleic acid interference (RNAi), 750

and Alternative Splicing of Transcripts, 395-396

Applications, 400-401

CRISPR-Cas9 and gene editing, 401-405

Comparison of CRISPR-Cas9 with RNAi,

CRISPR-Cas9 mechanism of gene editing or gene silencing,

Expression des prokaryotischen CRISPR-Array-Locus,

Effective SiRNA Design, 391–395

endogenous silencing pathways, 380-381

Essential RNAi Terminology, 376-378

Exogenous Silencing Strategies, 384-385

functionality, 396

key steps in the RNAi process,

miARN, 381-383

shRNA approach, 387-389

siRNA

approach, 385-387

Methods of Delivery in Mammalian Cells, 389-391

oppression, 394

Validation, 398-400

Analysis of the North, 399

RT-PCR Approaches, 399

western analysis and other protein methods, 399-400

Problems in vitro and in vivo, 396-398

pros and cons of RNAi,

Ribonucleic Acid Isolation, 666

of the bark, 171-173

of liquid matrices, 116-118

of fruits, 173–176

Freeze drying of plums before fruit processing,

of the sheet, 169-171

lipid-enriched tissue, 151-152

and peculiarities of plants, 163–167

electrophoretic profile of RNA isolated from plant tissue,

plant tissue with hot borate, 176-178

Protocol, 100-103

and quality control, 704-705

Reagents, 151–152

from the same source, 107-111

Strategies for Organs and Tissues, 192–193

Occurrence of incompletely dissolved RNA,

Purification Methods, 157–159

Sampling in the Field, 156–157

fixed cloth, 146-147

fresh tissue, 144-145

frozen tissue, 145–146

LiCl Harnstoff Method, 147–151

lipid-enriched tissue, 151-152

RNAm polysomal, 154-156

Purification of mRNA bound to polysomes and proteins, 152-154

Troubleshooting Tissue RNA Isolation, 159–160

Plant Tissue Strategies, 178–179

bodies, 135-136

LiCl-urea method for, 147-151

Samples, 143–144

Plant Tissue Problem Solving, 179–180

of leaven, 114-116

Ribonucleic Acid Polymerase I (RNAP I), 167

Ribonucleic Acid Polymerase II (RNAP II), 576

Ribonucleic Acid Polymerase III (RNAP III), 167

Ribonucleic Acid Polymerase IV (RNAP IV), 167

Ribonucleic Acid Polymerase V (RNAP V), 167

Ribonucleic Acid Sequencing (RNA-seq), 745-746

Data Analysis, 711–713

In silico workflow for RNA-seq,

Basic Vocabulary, 698–699

Pros and cons of RNA-seq,

Justification, 697–698

Variations, 713–718

CaptureSeq, 714–715

CEL-Seq, 715–716

comparison Of Gene Expression Assays,

cP-RNA-seq, 717-718

DropSeq, 715

Global Transporter Sequencing, 716-717

TIF-seq, 716

Workflow, 703-713

cDNA synthesis, 708-709

In vitro workflow for RNA-seq,

Library extension, 709

Next Generation Sequencing, 709–711

RNA enrichment, 705-708

RNA fragmentation, 708

RNA Isolation and Quality Control, 704-705

RNA Sequence Data Analysis, 711-713

Ribonucleic acid-dependent RNA polymerases (RdRPs), 595

Ribonucleic acid-directed DNA methylation (RdDM), 24

Ribonucleic Acid-Induced Silencing Complex (RISC), 378

Ribonucleoprotein (RNP), 730

complex, 707

Ribonucleosidotrifosfato, 4-5

ribosonda,

Ribosomal protein 49 (RP49), 265

ARN ribosomal (rRNA), 555-558

Ribosomes, 13-14

Profile, 153–154

Scanmodell, 31

Ribosome binding sites (RBS), 38-39

Ribointerruptor, 40

ribozyme,

Ribulose-1,5-bisphosphate-carboxylase/oxygenase (RUBISCO), 323

RID number,verRequest identification number (RID number)

REIN,verRibonucleic Acid Integrity Number (RIN)

REST IN PEACE,verRibonuclease inhibitor protein Ribonucleic acid immunoprecipitation (RIP)

RISK,verRibonucleic acid-induced silencing complex (RISC)

RNS,verribonucleic acid (RNA)

ARN-ISH,verRibonucleic acid in situ hybridization (ISH RNA)

RNA Sequence,verRibonucleic acid sequencing (RNA-seq)

ARNe,verRibonucleic acid (RNA) amplification

on us,verribonucleic acid interference (RNAi)

157

RNAP yo,verRibonucleic Acid Polymerase I (RNAP I)

RNAPI,verRibonucleic Acid Polymerase II (RNAP II)

RNAPIII,verRibonucleic Acid Polymerase III (RNAP III)

RNAPIV,verRibonucleic acid polymerase IV (RNAP IV)

RNAP-V,verRibonucleic acid polymerase V (RNAP V)

RNAse,verRibonuklease Ribonukleasen (RNasa)

RNasi, 56–57

RNäsing, 799

RNP,verRibonucleoprotein (RNP)

Robotic Fluid, 629

manipulation, 83

Rolling Circle Gain (RCA), 292

RNA root,

O rotor, 822-823

rp49,verRibosomal protein 49 (RP49)

RPA,verRibonuclease Protection Assay (RPA)

RpoT gene family, 167-168

rRNA,verRibosomal RNA (rRNA)

RT,verReverse transcriptase (RT)

RT-Xenopolymerase (RTX), 209

verReal-time polymerase chain reaction (RT-PCR)

RTX,verRT-Xenopolymerase (RTX)

RUBISCO,verRibulose-1,5-Bisphosphate-Carboxylase/Oxygenase (RUBISCO)

RuBCase,verRibulose-1,5-Bisphosphate-Carboxylase/Oxygenase (RUBISCO)

26S-Proteasom, 265

28S-rRNA, 266

S-adenosilmetionina (SAM), 30

S1 analysis, quantification of transcripts by, 561-565

S1-Test, 569

S1-Nuklease-Test,

to quantify specific RNA species,

845

security light, 537

Equipment Maintenance and Safety Considerations, 444–445

Material Safety Data Sheet (SDS), 787

INTELLIGENT,verSerial Analysis of Gene Expression (SAGE)

Saline Sodium Citrate (SSC), 476

EDTA Sodium Saline Phosphate (SSPE), 476

saliva, 767

Salt in rigor, effect of, 74

verS-adenosilmetionina (SAM)

Sample capacity to support RT-PCR, 199-200

Sample capacity to support in vitro translation, 200

Sanger sequencing, 844

Sarcosil, 592

Sarkosil,ver

SARS-CoV,verSevere Acute Respiratory Syndrome Coronavirus (SARS-CoV)

SARS-CoV-2,verSyndrome-Coronavirus 2 (SARS-CoV-2)

SBS,verSynthesis Sequencing (SBS)

Scatterplot analysis compares two sets of data,

scorpions, 316

Bi-probes,

RCP, 316

probes, 316

Scratch cells, 580–581

ARNc,versmall cytoplasmic RNA (scRNA)

scRNA-seq,verEinzelzell-RNA-seq (scRNA-seq)

ASD,verStrand-Displacement-Amplifikation (SDA)

SDB,verMaterial Safety Data Sheet Sodium Lauryl Sulfate (SDS)

second strand of cDNA, 211

Synthesis, 233-234

sedimentation rate, 826

Samensequenz, 392

Self-Sufficient Sequence Replication, 292

Electrotransferencia semi-seco, 482

Semi-nonspecific hybridization, 505-506

Senescent cells, 653

Sense RNA Probe Synthesis, 509–513

RNA 5' end tag, 513

In Vitro Transcription, 512-513

RNA 3' end tag, 513

Sensitive Nucleic Acid Stains, 190

Sensitive Quantitative Tests, 773-774

sensitivity

Index, 302–303

editions, 775

sequencing

depth, 698

Synthesis reaction, 700

Sequencing by Synthesis (SBS), 702-703

Serial Analysis of Gene Expression (SAGE), 750-751

Severe Acute Respiratory Syndrome Coronavirus (SARS-CoV),

Y-box 2 (SOX2) sex determining region, 769

Mock prehybridization, 614-615

short hairpin RNA (shRNA), 378

approach, 387-389

comparative Anatomy Of siRNA And shRNA,

In vitro method for shRNA production,

In vivo transcription model for shRNA production,

Short Interfering RNA (siRNA), 378-379

approach, 385-387

Methods of Delivery in Mammalian Cells, 389-391

effective design of, 391-395

Examples of effective siRNA design guidelines,

selected siRNA and shRNA design tools,

In vitro synthesis of a heterogeneous pool,

Short-Term Storage of Purified RNA, 118-119

ARNhc,vershort hairpin RNA (shRNA)

SI units, 853–854

Sickle Cell Anemia, 732-733

Direct Comparison, 665–666

characters, 723–724

Silanization, 819-820

silencer, 17

silica column

Focus, 83–84

Cytoplasmic RNA Isolation, 84-85

Products based on silicate filters, 83

Silica Microspheres, 630

Silica Technologies, 83–84

Silver stain, 441–442

Single gene locus, alternative messenger ribonucleic acid splicing, 42

Single Nucleotide Polymorphism (SNP), 744-745

Einzelzell-PCR, 279–280

Einzelzell-RNA-seq (scRNA-seq), 699

Single codon amino acids, 241

single Copy Gene,

Simple Phyta-Specific Nucleases, 549

Simple phyta DNA (ssDNA), 630

Single stranded DNA binding protein (SSB), 279

single-stranded RNA, 691

siRNA,vershort interfering RNAs (siRNAs)

Mitochondrial 16S rRNA, 266

Subunit 60S, 428-429

skin fibroblasts, 768

Slot Transfer, 830–831

small cytoplasmic RNA (scRNA),

Small non-coding RNAs (sncRNA),

small nuclear ribonucleoproteins (snRNP), 34

ARN nuclear pequeño (ARNsn),

small nucleolar RNA (snoRNA),

Instant Frozen Cloth, 159

sncRNA,verSmall non-coding RNAs (sncRNA)

SNP,verSingle Nucleotide Polymorphism (SNP)

ARNsn,versmall nuclear RNA (snRNA)

snRNP,versmall nuclear ribonucleoproteins (snRNP)

Natriumacetato (NaOAc), 592

Sodium concentration, 499-500

Natriumdodecilsulfato (SDS), 801

and potassium acetate reagents, rapid RNA isolation with, 111-112

Sodium Phosphate Electrophoresis Buffer, 423-424

solid phase extraction, 83-84

Solutions, 815

POP,verStandard Operating Procedure (SOP)

Southern Spots, 523–527

SOX2,verSex determining region Y-Box 2 (SOX2)

Layout of space, 608-609

Spatial resolution, 456–457

Spatial Transcriptomics, 623

Specific Inhibitors, 56-58

Test,

Spectrophotometric Analysis, 705

Spike-Protein, 760

Espleisosomas, 769-770

amendment, 28

Splinkerette Amplification Strategy, 281–282

Splinkerette-PCR,

SSB,verSingle-stranded DNA binding protein (SSB)

SSC,verSodium Citrate Salt (SSC)

ADN ss,verSimple phyta DNA (ssDNA)

SSH,verSubtractive Suppression Hybridization (SSH)

SSPEverEDTA Sodium Saline Phosphate (SSPE)

Agarose gels for staining, 442

Colorant

box,

Stainless steel generators, 139

Standard Curve Method, 309-310

Standard nucleotide burst, 682

Standard Operating Procedure (SOP), 52

Standard RNA Isolation Techniques, 152

Steady State Analysis, Nuclear RNA Extraction for, 596-597

Steady-state nuclear RNA begins, 597

Steady State RNA, 78

Relationship to Study, 579–581

stem-cells, 768

rod tie rods, 362–364

Sterile Water Options, 60–63

fallback solution

Mass to moles, conversion 793

Strand Displacement Amplification (SDA), 291-292

strangulation, 71

phone meeting, 71

Streptavidin, 611

Constraint, 500

Importance of control, 72-76

factors that affect the structure of nucleic acid,

Effect of formamide on rigor, 75-76

Effect of pH on rigor, 75

Effect of salt on rigor, 74

Effect of stringency on nucleic acid structure,

Effect of Temperature on Rigor, 75

Effect of urea on rigor, 76

Types of Double-Stranded Molecules, 71-72

structural Genomics,

By structure, 697-698

Subcellular compartment, 1

Subtraction Hybridization Method, 653

Subtractions-Exclusions-PCR,

Subtractive Hybridization Methods, 505

Sucrose, 98-99

sulfate, 804

Sellers, 859–866

Deleções-PCR,

Subtractive Suppression Hybridization (SSH), 753-754

Adapter-linked cDNA tester for hybridization and PCR,

PCR-Select cDNA-Subtraktionssystem,

Subtractions-Exclusions-PCR,

subtraction Suppression Method,

Deleções-PCR,

SYBR-Oro, 808–809

SYBR verde, 808

Essay, 311-312

for real-time polymerase chain reaction,

Comparison of ethidium bromide and SYBR stains,

Elimination, 813

Plates, 190-191

SYBR green stained RNA gel, 193-194

SYBR Grün I, 808–809

SYBR Verde II, 808-809

SYBR Safe Dyes, 808-809

Symmetric PCR, 226

Syndrome-Coronavirus 2 (SARS-CoV-2), 760

Systematic ligand evolution by exponential enrichment (SELEX), 691

T cell receptor genes, 745

Infected T4 phageEscherichia colicells, 27

TA Cloning Ligation Reaction, 287-289

Tagged Image File Format (TIFF), 462

THREE,verThe Arabidopsis Information Resource (TAIR)

HIT,verTobacco acid pyrophosphatase (TAP)

TaqA tail product, 285–286

TaqPolymerase, 276-278

TaqManName

5' nuclease assay for real-time polymerase chain reaction,

Essay, 312–314

reporter-extinguisher-probe combinations,

Target DNA, preparation of, 588-589

target molecules

Target RNA, 489

tasiARN,verSmall interfering RNAs that act in trans (tasiRNA)

TATA Box, 16–17

Taxonomy, 694

TBE,verTris-Borato-EDTA (TBE)

telomerase RNA,

Strict temperature, effect of 75

Temperature control, 803

model thread, 18–19

Model Change Approach, 211

Template-Switching-Oligonukleotid (rG), 211

Terminal transferase, 272–273

Termination, 24-26

examiner, 652

SNA, 658

Test-Off Systems, 750

Tet-on-Systeme, 750

Tetracycline (tet), 841

Tetranatriumsalz 786

The Arabidopsis Information Source (TAIR),

"Thematic" Matrices, 850-851

Theranostic Approach, 731–732

Therapeutic scheme, 724

Thermodynamic Behavior, 559.

Thermodynamic Stability, 604-605

Thermostable DNA polymerase, 229

Enzima termoestable, 256-257

Polimerasen termoestable, 256-257

Stability of selected polymerases used for PCR,

Term Water(Taq), 229

Thin Layer Chromatography (TLC), 197

Third Generation Sequencing Methods, 700

3' RACE-PCR,

3,3',5,5'-Tetrametilbencidina (TMB), 534

3'-hydroxyl group, 7

3'-fosfomonoesterasa, 552-553

3' Poly(A)-Trato, 122

3' final marker

about ADN, 509

of RNA, 513

Molecula central 3'polyadenylada, 362-364

3' Primer, 239–240

3' untranslated region (3' UTR), 392

Threshold Cycle (CT), 309

Timidina, 184–185

Timina (T), 501

TIF-seq,verTranscript Isoform Sequencing (TIF-seq)

FIGHT,verTagged Image File Format (TIFF)

Tissue-Tek optimal cutting temperature (Tissue-Tek O.C.T), 145

Screens, 135-137

Culture, 135–137

Advantages of Cell Culture, 136–137

Benefits of tissue samples, 137

fixing process, 611

Homogenization Methods, 137-142

BeadBeater Homogenization, 141-142

Dounce Homogenization, 140-141

motorized homogenizers, 138-139

RNA Isolation Strategies for Different Organs and, 142-156

“Cleaning Methods,” pgs. 157–159

Sampling in the Field, 156–157

fixed cloth, 146-147

fresh tissue, 144-145

frozen tissue, 145–146

LiCl Harnstoff Method, 147–151

lipid-enriched tissue, 151-152

RNAm polysomal, 154-156

Purification of mRNA bound to polysomes and proteins, 152-154

Troubleshooting Tissue RNA Isolation, 159–160

samples, 154

dear,verThin Layer Chromatography (TLC)

Tobacco Acid Pyrophosphatase (TAP), 273

Tonoplasto, 164

TOPO Cloning Method,

ARN total, 77-78

Gestivo RNA-seq, 705-708

Touchdown-PCR,

Toxic Compounds, 442–443

tracrRNA,vertransative crRNA (tracrRNA)

Trademark, 867–870

Traditional crosslinkers, 689

Fanver3' untranslated region (3' UTR)

small interfering RNAs (tasiRNA), 400-401

ARNcr (ARNtracr), 403

769–772

Transcript Essay, 549–550

Transcriptional Isoform Sequencing (TIF-seq), 716

Transcript Processing, 769–770

Transcript quantification

by competitive polymerase chain,

by RNase protection, 565-568

by analysis S1, 561-565

Transcript Templates, 323

Transcription Process, 24–26

Research Methods, 302

Command, 265–266

factors, 16

Influence on the organization of genes and genomes, 19–24

higher order folding of nucleic acids and proteins,

Fee Essay, 579-580

Comparison,

nuclear run-off versus nuclear run-on test, 581-582

Relationship to Steady-State RNA Study, 579-581

Ribonucleic Acid Polymerases and Their Products, 24-28

eukaryotic Ribonucleic Acid Polymerases,

an rRNA biogenesis pathway in human cells,

Vectors, 389

transcription start site (TSS), 776

regulation of transcription, 44

transcript, 744

Aptamer Biology, 691

Bioinformatics, 691–692

Epitranscripción, 685-688

Basic Vocabulary, 681–684

Gen – Explosion, 692–694

RNA-Chromatin, RNA-RNA, and RNA-Protein Interactions, 688-690

CLIP-Workflow,

Transcriptomes and Transcriptomics, 684-685

transcript, 744

tool, 697

Transcripts, 571–572

Calcium Phosphate Coprecipitation Transfection, 390

"Transmission Membrane", 473

Transfer RNA (tRNA), 416-417

Transiluminador, 454

Translation, 13–14

Affects the sequence and structure of messenger ribonucleic acid, 40-42

translation efficiency, 37

translation check,

TRI-Reagenz, 151–152

Tris,verTris(hydroxymethyl)aminomethane (Tris)

Tris-Borat-EDTA (TBE), 564

Tris/SDS-Puffer, 841

Tris(hydroxymethyl)aminomethane (Tris), 841

trizol, 166

ARNt,vertransfer RNA (tRNA)

Troubleshooting, 673-676

Kern RNA Analysis, 599–600

Quantitative Polymerase Chain Reaction Techniques, 345-348

TSS,verTranscript Home Page (TSS)

tumor cells, 730

Turbo secant, 480

TurboBlotter RNA Downblot, 486-488

Tuschl Rules, 392–393

smoking, 713

Two-Dimensional Gel Electrophoresis, 848-849

Two-Dimensional Gel Method, 848-849

2-mercaptoetanol, 598

Tyramine, 612

enhancement of tyramine fluorochrome ISH signal,

you

Ultracentrifugation, 824

Ultracold storage, 145–146

Ultraviolet (UV)

absorption rates, 786

Nucleic Acid Sample Absorption Profile, 184

Crosslinking by UV radiation, 489-491

RNA Crosslinking with Nylon Filters, 491

luz, 454

recording, 498

Those, 588–589

Measures, 186

evaluation of oligonucleotide purity by UV shading,

Shadow Technique, 197

Protocol, 198-199

Spectrophotometry, 183-191

Transiluminadores, 454

A,verUnlocked Nucleic Acid (UNA)

MI,ver(UNG)

Sonda Uni, 316

UniProt (Human Proteome Organization), 851

unit analysis,

United States Patent and Trademark Office (USPTO), 404

ANN Universal Reference (URR), 644

ARN universal, 311

Unlocked Nucleic Acid (UNA), 394

unzip, 71

Positive Regulation, 653-654

Oberstrom, 8

Upstream Primer, 239-240

Uracilla (U), 553

(UNG), 709

Harnstoff, 504–505

denaturation, 421

comparative denaturing electrophoresis,

Protocol, 421

Effect of urea on rigor, 76

Urea-based hybridization formulations, 505

tu,verUniversal Reference ANN (URR)

USPTO,verUnited States Patent and Trademark Office (USPTO)

ultraviolet,verUltraviolet (UV)

Vaccines, 760-761

Vaccine-Induced Side Effects, 761-762

vaccines against COVID-19,

void stain, 480-481

System, 480–481

Vacuum Assisted Capillary Transfer, 480-481

Vanadilribonucleósido (VDR), 611

complexes, 57

Vanadyl ribonucleoside complexes, synthesis of, 68-69

Gen variable, 844

Vascular Endothelial Growth Factor (VEGF), 772

VDR,verVanadil-Ribonucleosídeo (VDR)

vegf,verVascular endothelial growth factor (VEGF)

Venerable Gene Expression Tools, 629.

Venerable Northern blot analysis, 611

Vertical Rotors, 822–823

ARN viral,

Viral Transduction, 390

Virus, 609-610

Viscosity, 503-504

visualization method, 197

Agua, 841–842

phenol saturated with water, 599

Watson-Crick-Basenpaarung, 71

WebLogo (web-based tool), 788

Western Analysis, 399–400

WGS,verWhole Genome Analysis (WGS)

wheat germ extract, 200

Whole Genome Analysis (WGS), 702-703

Whole tissue, alternative protocol for dissection of cell nuclei from, 584-585

Analysis of the whole transcriptome, 629.

profiling the entire transcriptome, 1

Hybridization window, 550-551

Task Force Advisory Committee, 766–767

World Health Organization, 767

x-ray film, 787

inherent limitations of, 467-468

Prosecution, 539–542

Xenopusovules, 603-604

XIST, 357

and Gen, 357-358

RNA-Y,

YAC,verYeast artificial chromosome (YAC)

Yamanaka Factors, 768

Yeast

culture medium, 114

RNA isolation from, 114-116

Of hybrid systems, 850-851

Yeast artificial chromosome (YAC), 844

Zinc-Dependent Metalloenzyme, 552-553

(Video) How to use CRISPR Cas9 for knockout, knock in and gene activation

zipper, 71

Chapter 392: Table of Contents – RNA Methods: A Laboratory Guide to Isolation and Characterization (2023)

Videos

References